Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11535  (registered. 2003)
Contig Information
Length 808 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 3
Homology (BLAST) Top Hit putative helicase [Oryza sativa (japonica cultivar-group)] >gi|31432486|gb|AAP54108.1| AT hook motif-containing protein, putative [Oryza sativa (japonica cultivar-group)]
Score 119
Evalue 1.36223e-06
Total Hit Count 96
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11535
ACATATGCCTATTTTGCGCAAGAAGACTTAAAGCTCAGGTTGACACATCTGCAACATAGAAACATTACAAGACATCACACCTAGCGAATCAACACATGCC
GCCACACGTCACAACACTGTTACGACATATTGAAGGCAGATCCACACAACACATCCACACATGCCAAGGACGGTCAGTTGCACCGGCAAGGTCGATGCTA
AGGTCGATCAGTTGCAACGGCAAGGTGGATGCTGAGGACGATTAGCTGCACCTGCAAGGTTGCTGCCTCGCCTATCAAAGGGGATGGTAGGACACCCATC
ACATTGAAGGCCCGAGGAAGGAACAACAGAAACAACATCAACTTTGGGTAAGAACACTTCAAGTTCTTCAACACATGCTAAGGACGATCGATTGCACCAA
CAAGATCGGCATGACACCCCGCGTATCCAAGGGGGCGGCAAGACGCCTAGACACATCGAAGGCCTAAGCCTGGACCCAGTGTGGAAGGCAACATGCAGCC
TACGGAGTTCCTCAACACCTTGACATCCCTAGGAATCCCTGACCATAAGTTAAAACTGAAGGTGGGTTTGCCAATCATGCTCCTCAAATCATCATGTTAC
CCAGCAACGCAAAATGACCATTCGTGCTTTTTCCTCTAGCAATGGATATCAACTCTATTTAATCTATCCTCATCTCTCTCATACCACATACTTCCAGAAG
ATGTCGATCTCCAGCTCAAATCAATCTAATGAATAGTCCCCATATCCCAATATCTATAATATCAGCTCCATGAAAAAGTGCCTGTGCAAGCTACCCCAAA
TCCATTCG
page-top