Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11524  (registered. 2003)
Contig Information
Length 844 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit unknown [Zea mays]
Score 751
Evalue 8.98729e-78
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11524
AAACCCGAGCAAAACCTGTTACAACACACCTAAACCGCCATCATGAGACATGGCCATGCATAGGGCACTGCCGACCACTCTTGTAGGTACATAAGGTACT
ACATGATGTATATGTAATAAACCACTATAGTTACATCCAACATTTATTTACATAGGATAACTCGACATTTCCACTATCTGTTTACGGCTCATTGCAGAGC
ACGCGATCCTGTACTGTTGAGCTCGTTCTGAACATAGATGCCATTGTTCTTCAGGAAGCCAGAGTACCAGCGAGCAGAGAGCTTGGCTTGTCGTGGCCGC
GCCTCATCGCTAAAATCAACACGGTATAGGCCGTACCGTGACTTGGGCCCTGCAAAGAACTCGAAGACGTCTAGGAAGGACCACACAAAGTAGCCTTTTA
CGTTTGCTCCATTCCTTACTGCCCTCAGTGTGCTACCCATGTAGCTCTTCAAGTATTCGATCCTTTCGGTGTCATCGAGAGTGTCATTAGATGCAACACC
ATTCTCTTGCACATAGATAGGAAGGTTCCCATAGGCTTTCGTAAGGTACTGCAACACATATTGCAATCCTTCCGGGTCACTTTGAGAAGATGATGGGACA
TTCTTGCTACTTCCTGGGATTGTTTTAGAAGCTCTTTGGTAAAGAGACATGTCTGCTGAATAGTCGCGAGTGCCTTTGTCTAAAGGACGATCATTAACAT
ACATGGAATAGTAGTGGTTTATTCCTATGAAATCAACAGTTCCCTTGACAACTTGAGATTGAGATTTTGTAAAGGATGGAAGTCGAGACCCAACATTTTT
CTTCATCACATCTGGGTAATCTCCAGACACCAGGGGCTCTAGTA
page-top