Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11477  (registered. 2003)
Contig Information
Length 748 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsI_18069 [Oryza sativa Indica Group]
Score 589
Evalue 4.38048e-59
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11477
CTTGAATCCATACACATTTTACTTCTACACAGAGCAGAGAAGAGAAGAGCCATCGTCTCCTCCGCCTTACCCTTACCCTTACCATACCATCCATCACTTG
TCCAAAATGCACACGCCAAACTACCTACGACATACATACATTCTTCCACTTCCAGCACCTTGCTTGTGACATTACTACTTGATTACCCTAGCTAGTTGGT
TAATTAGCCCTTCCTAAACAAGCAACCATCGCATCGCATCAACAACCTTCTAATACCTCGGCTCATCCCGCGGTACCGGTAACTCTGCTCCTCCTCCTCT
CCTTCCTTAGAAGGTGGCGCCGGCCTCCCCGGCAGTATCTGCTTCCGCAGAGGCACTCGAACGCTTTCATGGGCTGCCTCTCGTCGTCGAAATCGATGCC
GTAGTCCCATGTCAGTTCCTCAAAAGCCTCCACCTTCTTGCTTGTGAAGAATGCAACATGATAATACTGATGATCAGGGGTCTCCACTTCAACAGGAATC
ATGGCTAGATTTGCATCACAGCATCTGTGGTTGATGAATCTGCCAACATTCCCATAGAATGTTCCATCTAGGCATAAAGCCTTTTCATCCTTCGGCTCCC
CTCCAGAACACCAACCGGCATCCAAAAGTATTGGATGTGTATACCTAGCATTCTGCATATTTTGAATGGCCCTTTCATGCAGTTCTGTATGTGTTAGTAT
CTCCCCAGCATATTCACAAACAAAAGTGCCTTTTGGGCAANTCATCGA
page-top