Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11447  (registered. 2003)
Contig Information
Length 858 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 3
Homology (BLAST) Top Hit carbohydrate-selective porin [Zymomonas mobilis subsp. mobilis ZM4] >gi|56542534|gb|AAV88688.1| carbohydrate-selective porin [Zymomonas mobilis subsp. mobilis ZM4]
Score 90
Evalue 0.412558
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11447
GAGCACATATATGTTTCTAGGTGTGCCACACAATAAAAAATGAAGTGGTGCCACAAAGGGAGGAGTACATATGTTTCTAGGTGCGTCACCCAACCAGAAA
AGAGCATACAGTGGCTTATGTGCCAAAACAACCACCAAAATGAGCAGCACGTGCCAATGTCACCAGGTTCAACAAACAAGGTACATTACATAACCACTCC
ACCAACTTAATTGTAGGTCTTGCAAACATTCAACAGCTTGTAGGTGATCCAAGCCTTAACTTGTAGATCATCCAAACCTTCAGAAGCTTGTAGATCACCC
AACTTAATTGTAGGTCTTGCAAACATTCAACGGCTTGTAGGTGATCCAAGCCTTAACTTGTAGATCATCCAAACCTTCAGAAGCTTGTAGATCACCCAGT
GTATCTTTGGGAAACAAAGTGTATTCTCTGCATTCACAGAAAAAAGTGTATTCCCTGCCTCCATTCAAACTTCTCCTCCGAGCATGTTGTAGCCTTTGCT
TAGCTGCTAGTGACTACTTGTCATGTCATAATACATGGAACATATAAGAATCAGTGCTTCATGTTATTCTTATGAAATAGTAACTTATATTGAGTAAAAA
CTAGATTGGAGATAAAGGAACCGTAGAAAACCAACATATTATACTACCTCCGTCTCATAATGTAAGACGTTTTTTGACAATACTTACATTATGGGACAGA
GGGAGTACCATTTAAACTCTAGAAGAGTGGTCCACTTTCAGTCTGTCTTGCAGCAAAATGAAAGGAGGCGTAAACAAGTTCTCTAGCTAGTTGTTTTCTT
CCATGTAGTAGTATATGTGTGTGATGACAGTTGAACTAGATGATCTCACATCGATCAA
page-top