Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6486  (registered. 2012)
Contig Information
Length 1063 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222635026|gb|EEE65158.1|| hypothetical protein OsJ_20259 [Oryza sativa Japonica Group]
Score 712
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6486
TGGGGAGACTACGATTCACATGACATAGAACGTTATACAAGAGCAAAATTTATGGACTACACGACAGATAATATGTCCATCTACCCTTCTCCGACTGGAG
TGATGATTGGACTTGATCTAGCTTATAATTTGCACTCTGCTTTTGGCAATTGGTTCCCTGGGTCAAAACCCCTCCTCCAGCAAGCAATGAACAAGATCAT
GAAGTCAAATCCTGCTCTGTATGTGCTGAGGGAGAGAATAAGAAAGGGTCTTCAGTTGTATTCATCTGAACCCACCGAGCCATATCTGTCTTCGCAGAAC
TATGGAGAGATATTCAGCAATCAAATCATATGGTTTGTGGATGACACGAATGTCTATCGAGTTACCATTCACAAAACCTTCGAGGGTAACCTGACCACCA
AACCTATCAACGGTGCTATCTTTATTTTCAATCCAAGAACTGGGCAACTATTTCTGAAGGTCATCCACACAAGTGTATGGGCAGGACAAAAGCGTCTAGG
GCAGCTGGCCAAGTGGAAAACTGCTGAGGAGGTTGCTGCGTTAGTTCGGTCTCTTCCTGTAGAAGAGCAGCCAAAGCAAATTATTGTGACAAGGAAGGGT
ATGTTGGATCCATTGGAAGTCCATCTGCTTGATTTCCCTAACATTGTTATCAAGGGCAGTGAGTTGCAGCTGCCATTCCAAGCTTGCTTGAAGATTGAGA
AGTTTGGTGATCTTATTCTCAAGGCTACGGAACCGCAGATGGTTCTTTATAACATATACGATGACTGGCTGAAAAGTATCTCGTCCTACACCGCATTCTC
TCGTCTTGTGCTTATATTACGAGCATTACATGTCAATAATGAGAAGGCCAAGATGTTGCTGAAGCCTGACAAGACAATTGTTACGGAACCACATCATATC
TGGCCATCTTTGACTGACGAGCAGTGGCTGAAGGTCGAATGTGCACTCAGGGATCTCATTCTTTCTGATTATGCAAAGAAAAACAACGTTAATACTTCTG
CACTTACGCAATCTGAGATTCGTGATATAATACTTGGTGCTGAAATAGCTCCACCGTCACAGC
page-top