Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11428  (registered. 2003)
Contig Information
Length 589 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Homology (BLAST) Top Hit hypothetical protein OsI_11539 [Oryza sativa Indica Group]
Score 407
Evalue 3.24807e-38
Total Hit Count 229
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11428
TAGTAAAGTAAGGGCCAAATCATCAGTATGACATTAAGCAACGAGATAAGGTACACATATCAAGCATTCAACACAGATTAAACTCAAAACATGTTCACAA
GAAACCAGGCCTAGCTGACATCAAGTCTTAGCTTCCATAGTAGCAACTGAAACTAACCACAGACATCCAAGAGCTAGGTAGACATGGGAAGGAAACAAGT
TCCAGGTAAAACTAGTAGCAACATCTAGAGCTGCTTGATCTCAGCCTTCCTCTTCTGCCACAGCCTGTCCAGGGAGCCATCAGCATCACCCTGAGCACGG
ACAAACCCAGAGAGAGCAAAGGTGGTGAAGCGGCCATCATAGAGGCCATTCTCATCAACGTGACCAATGTTGATCTGGACAGAGGCGTGGTCCTTGGCCG
TGATGATCCTGTTGGTGGCCGAGCACTTCCTGGGGATGTAGAGGTCCACCATGTCACCCACCTCGTTCTGCATGGTGGCGGCTGGTGGGGGAGTGGCACA
GCAACAGCGACGAAAGGAGGTGGCAGAGAGGGACGCACCTTGATCTCTTGGATTCGAGGAGGCGCTGCGGGAGGACGAAGAGAAGCTGG
page-top