Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11394  (registered. 2003)
Contig Information
Length 926 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsI_24463 [Oryza sativa Indica Group]
Score 755
Evalue 3.63893e-78
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11394
ATTTTTAACAGCACCACAGTTAAAACAGCGGCTGAACTATATGGTTCAGGCAGAAGGATGAATGGAACTGCGGTTATACATCTCTAATGATTTATGAAAA
CCGGGCAAATGCGCCCAGCCTTTACACACACAATCAAGATACAACAAATGTCTGTCATGGTTGCGATTTCGATACACCACATCTAAGGTAACAACAATTC
ACGATTGGGTTTGCACTACGAATCACGGACCCGGGAACAGGGCATCATCGTCGGTTATTCTGGACCCCCAGGGATATAACTTCTTTTTCTTTTCACTGCC
GCGGCAATGTAACTGTAAGTGACATCAGTTGGACAAGAGCAGGTTTCTTATCTGGTGTATCTGTCTTCTGCTAGTTTGGACGGTTCAGAGCCATGAACTT
GCACTGCTCACTCATCGCCTGGAGCTGTGCATCCTTCTTGTCGACCATGGCACGTAGCCTCACATTTTCCTCCATCACCTTCTGGACTTCAGCTTCTTTC
TGTGCCTTCTCAGTCTCGAGCTGGTTGGTCCTTGCGACTAGCCTGTCAAAAAGCTTCTCCATTGTCTCGAATTGCTTCTCCGATGAAAGAAGAGTTTCTC
TGACACTAACGAGTGTGCTGACATAAGTTCTGAGCGACTCAAAGTCGTTCTTCACACGACTAAGCTCCTGCTCATTTTCAGCAGCGCGCTGCCTCTGCCG
AGTGGTCTCCAGCACCATATCTTCAACCCGCTGCCTCATCTCATTCAGCATACCGTTCGTACCCACTGCAAATTTCTCCATCTCCTCGACTTTGACCGAC
ATGGACTCGACCTGAATGGTCTTCCTCCTGATCTCTTCCAACCCAATCCTCACCTTTTCTTTCTCATTCGCAGTTTCGGACTCGGCCACAATCACTCTCT
TGACAANAGACTCCATGAACGTCGGT
page-top