Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6480  (registered. 2012)
Contig Information
Length 916 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 14
Wh_V483 Shoot grown under cold condition for 3days 10
Wh_VHS Shoot with heat shock treatment 12
Wh_VWD Shoot grown with dessication 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|225690804|gb|ACO06088.1|| chlorophyll a-b binding protein [Triticum aestivum]
Score 458
Evalue 3.00E-127
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6480
TTTTTTTTTTGAGTAATGACACACGATTCTTCCATCCATTCCCTCGTGCACACCTTGTGCTTAATTAATTTACATTGCGCGCAGCTAGCGAGAGGACCTC
TCGCTCGCTCGATCATGGTACAAATAAACACACAAAGTACGTGCAGCTACACGTTGATCCACGACGTACAAGTACACATGCATATCTCGTCCGATGGACG
GACGGACGGACGGACGGCTAAACACATTTAGCTTCCGGGGGCGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTGACCGGGTCGGCGACGTGGTCGAAG
AGGTTCTCAACTGGCCCCTTCCCGGTGACGATGGCCTGCACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGAGCTCCTTCACCTTGA
GCTCGGCGGCGGTGTCGGGGTCGTCGGCGAGGCCAAGCGGGTCGAAGGCGCCTCCTGGGTAGATGATGTCGAGGCCCTCGCCGAGGGGGCCGCCACCAAC
ACGGTAGCCCTCGATGAAGCCCATGAGCACCACCTGCACCGCCCAGATGGCGAGGATGCTCTGCGCGTGCACCAGGTTGGGGTTGCCCAGGTAGTCGAGG
CCGCCCTCGGAGAAGATCTGGACGCCGGCCTTGAACCACACGGCCTCGCCGAACTTGATGCCGTTCTTGGACAGGATCTCCGGGAACACGCACCCCAGGG
CGCCGAGCATCGCCCACCGCGAGTGGATCACCTCCAGCTCCCTGTTCTTGGCGAACGTCTCGGGGTCAGCAGACAATCCGGCGGTGTCCCACCCGTAGTC
GCCGGGGAACTCGCCGGTCAGGTACGACGGGGTCTGCTCGGAGAACGGGCCCAGGTACTTGGGACGGTCTGGGCCGTACCAGATGCTCTGGGGCGCGCTC
TTGACGGTCCGGCGCA
page-top