Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11340  (registered. 2003)
Contig Information
Length 733 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
Homology (BLAST) Top Hit Os11g0143500 [Oryza sativa (japonica cultivar-group)] >gi|113644428|dbj|BAF27569.1| Os11g0143500 [Oryza sativa (japonica cultivar-group)]
Score 746
Evalue 2.65012e-77
Total Hit Count 271
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11340
CGCGACTCGACCGCCGCCGCGCACCCACTCCCGCTCCCCACGATGCGGCACCTCCTCCTCTCCCGTCTCCTCCGCCGCGCCTCCTCCCCCTCCCAGCCTC
ACCACAACCTCCAACTCATCCGTGCTCTCTCCTCCTCCTCCCCTCTCCCGGCCTCCGACACCGACCTCCGCAAGTACGCCGGCTACGCGCTCCTCGTCCT
CGGCTGCGGCGCCGCCACCTACTACTCCTTCCCCTTCCCACCCGACGCGCTCCACAAGAAGGCCGTCCCCTTCAAGTACGCGCCCCTCCCCGACGACCTC
CACACCGTCTCCAACTGGAGCGGCACTCACGAGGTCCACACCCGCGTCCTCCTCCAGCCCGACTCCATCCCGGCGCTCGAGGATGCCCTCGCCACAGCCC
ACAGGGAGCGACGCAGGCTCAGGCCCCTCGGCTCCGGGCTGTCCCCCAATGGCCTCGGGCTCTCCCGGGCCGGCATGGTCAACCTTGCGCTCATGGACAA
GGTGCTAGACGTCGATGTCAAGAAGAAGACCGTCACGGTGCAGGCTGGGATACGTGTCGCCGAGCTCGTCGATGCGCTCAGCAAGCATGGGCTCACACTG
CAGAACTTTGCCTCCATTCGAGAGCAGCAGGTCGGCGGCATCATTCAGGTTGGTGCCCATGGTACTGGTGCGAGATTGCCTCCAATTGATGAGCAGGTTA
TTAGCATGAAACTGGTTACTCCTGCCAAAGGGA
page-top