Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11109  (registered. 2003)
Contig Information
Length 828 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit thioredoxin-like protein 4B [Zea mays]
Score 729
Evalue 3.08777e-75
Total Hit Count 183
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11109
ATGGAGAATGTCATGCAAATGTCAATTTTAACAATTGATTGTATCACAAACAAAATATAACCAGACTTGTACCAAACTAACAGATGTGCACCTACTTAAC
TGCACAGACTAGAGAGGGCAAGACACCAATTGCTGTAGTGTTATGCTATGATAACATAGAGGAACATAGTTGATGCAAACCAGTGCAAAGGCCAACTCTT
GATTGTTCATCACCAAGCTCATGCAAGCACATCTCCATATCCGCCATGAACAGCTTATTCTTTAGGTCTGGTTGCCTGGATATGTATGCAGAGGATGGGG
GATGAAACACTTCCATTATCTAAAAGACTGTTACATATGTTGAGAATGTGTGCTTCTTGTGATTAGACATCCTTGAAAAGAAGCTGGAATCTGGGTATCC
TCTCTGGTGGAAGTGGGCAAGACACTATCAGTTTGCCTTTCATCGCGCCCCTGAATACTGCCTCAACAACATCAATGAAGTCTTGCTTGCTGCTGAAAGA
GCCTATCCATTTTGTGTGATCAGGTGTCCCTGAATCCATTTTCATGTGATGAGCGTTGAAGAAAAAAATGATTGCTGGGACCAACGTGATATCAAAATAG
TCAACATACACTTGAATCTCCTCAGAATCCATGTCAACTAATGCTACCGTTGCAAATTTGGATATGTCCCAAGAAGCTTTTGCGAGGACGTCGTCGAGTT
GGAGGCAGGCGGCGTCGGAGGCGCGGCCGAATCGGAGGACGAGGACCTTGTCGAGGGTGTCGCGGATGGCGGTGTCGACCTCCCGCTTCCGCCGCAGCGT
CGGCAGCACCACCGACCCCATCTCGCCC
page-top