Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6448  (registered. 2012)
Contig Information
Length 616 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_h Spike at heading date 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 5
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig6448
TTTTTTTTTTACACTAACATAGTAATTATTATTTATTGATGGTACATGTAGCACATCAAGGAACGAAAAATACGAGAACATGAACTGGAAATAGATAGTA
CAGATGACAGTTGATACAGGCGCTCAGTACCGAACATGGAAATGAGCAAAACGTCCGCTTTTTCCTTCCCGGCGGTGCTACCTACAGAATCTAAAGCGAC
AAGGCGAGCTTTAGCTCCTTGTAAGCCAGCACATGAGCCAGAGATGATCATGGGCCAATAGCAGGGATCCCAGGAAGCACCACCAGCGGGCCGGTAATGG
TGCTGGTTCCCGTACCGGTTCCCCCGAGCAAAGGCAAGTCCAACGCCTTAGACTCGCCGACGCCACCACCCGCACCTGCGCCACGCGTCGCTGCAACCTT
CTCATTCAGCTCCCTCCCTTCGCATGACGCGAGCACCACCAGCAGCAGGAGCGCGACGGCGAGACACTTTGCCATTGCTAACTGGGAGGCGGCTCTGGTA
ATAGTAGTACTACTACAGAGGAGATAGTGTTGTGTGGCTGTGTTTGAGTGAGCTTGGGCTTAGCATCGTGTACTCTGCCTCTTATAGGTGAGTTGCACGG
GGTGGCGGGGTGGCCG
page-top