Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6445  (registered. 2012)
Contig Information
Length 1183 bp
Clones alternative view 493 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_SH - 12
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 8
Wh_KMV Shoot grown with continuous light after cold treatment 14
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 10
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 28
Wh_V483 Shoot grown under cold condition for 3days 14
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 19
Wh_VWD Shoot grown with dessication 12
WH_XI Two-week old seedlingsi22 16L-8Dj 16
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 27
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 28
WH_XN Leaves, plant was grown at constant 23 34
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 13
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 38
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 41
WH_CA 3
WH_SP 9
WH_XE Seedling, infected with leaf rust 28
WH_XF Seedling, infected with leaf rust 41
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 25
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 24
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 8
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 24
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|18958|emb|CAA44777.1|| Precursor of CP29, core chlorophyll a/b binding (CAB) protein of"
Score 578
Evalue 6.00E-163
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6445
TTTTTTTTTTCAAAAAGAGTCAATCTGGTTTTTAACGATGATGAAAACCATTTCAGAAATTACTCAAGTAGCAGTGGTCCGATACTCCCATCAGAAATCA
GAACGGTCATGTTTCTTCTGCCCCTTGATAATTTACACGTACGGCACATTCGTACTCTCATACTTTTCCCCGGTAAAATTCACACAGCACATGATGCTGC
ATCGCGCGCATGCAGCTGATCATCAACAGCCGACGGCGGCGGACGGGCAATTAACGGCCAGCTCACAGGCTGGGCACCCTCTCGGCGGCGCCGGAGATGA
CGGTGAGCAGGTTGTTGCCGAAGGGGTCGCTGAGGTGCGCGCACAGGTTCTCGAAGGGGCCCTCGCCGGTGACGTAGGCCTGGATGAAGAACCCCAGCAT
GGAGAACATGGCCAGCCGCCCGTTCTTGATCTCCTTCACCTTGAGCAGCGCCGCCTGGTCCGGGTCGGTGGCGAGGCCGAGCGGGTCGAATGGGCCACCT
GGGTGGAGCTTGTCATCAAATTCCAGTCCGTTGGTGATCCTGTAGTACTCGGCGCCTCCGACGAGGACGACCTCGGCGACGACGGCGAGGATCAGGTTGA
TGGGGATGCTGTTGCCGAAGTAGTTGAGGGTGTTGCCGTCGAGGAGAAGGGCGCCGGTCTTGAACCAAACGGCCTCGGGGCCGCAGTTTGCGCCGAACTT
GTTGAGCGCCTCGGGGATGATGAATCCGGCGGCGCCGAGCATGGCCCACCTGGCATGGATGAGCTCAAAGGCCTGGTACTTGGCGAAGTCCTCTGGCTTC
TTGCCCAGACCAAAAGGATCATAGCCGTAGTCTCCGGGAACCTCTCCGTTGAGGTACTCCGGCACCTCCGACCGGTCAAGGAGACCGTTGGGCAAGTAGA
TCCTCCTGTCAGGGCCGTACCACTTGGCGAGCTCGTCGTCGATGCCTACGCTCGAGGTGGCAACGGGTGCGGGCTTCGGCTTCGGGGCGGGCTTCTTCTT
GAAGCGATCAAAGAGGGAGACGATCTTCTGTGCGCCAGCAGTTGGTGCCGCTGTGGCATACCTGGAGGATCCGGCGAAGTTGAGCCGGGTGCCGAGCATC
TTCGTCGGAGCGAGCGCCGCCATTGCCTCAGCCCAAAGTTGAGAGAGAAGGGGCGTGCTCAGCTCAGCAAGAAGGGAGCCTCG
page-top