Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10905  (registered. 2003)
Contig Information
Length 583 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Homology (BLAST) Top Hit hypothetical protein OsI_22100 [Oryza sativa Indica Group]
Score 302
Evalue 4.71965e-26
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10905
TGTTTGGTCATACAATTTCCTCGCCGAAAGCATGGCGGAGGAACATCGACATGCAAAAAGTAAAGCTAGGGCTCCTCTTGGAAAGATGTGGTGCAGTGGA
GGAGCCCCGCATTGAGGCGAGCGTTCTCCCGATTGAGCTCCTGCTGGTCGATGCAGTCCTTGGCGACGCCGACGCAGTTGGGGCAGGTAGCGGAGTTCTT
GAGCGCCTCCCGCACGGCCATGATCTCGGACCGGAGACTCATGTTCTCCCAGCGGAGGAAGCGATTCTCCAGCCGCTCGTGCTCAATCCTGATCTGTGTG
CGGTGGTTCTGGAACCAGGATCTGACCTGCTTGGTCTCCAGACCAAGCTCGCGTCCAAGCTGAGCGCACTCGATCTCACTGGGGTGATCGGACTTCTTGT
ACGACTCCTCCAACTTCTGGACCTGCTCCGGTGTGTGGCGGCGTTGGCGCTTCCGGCGCTCCTGCAGCTGCTGCTGGCTGTCGGAGCCCCCCTGCTGGTG
GTCGCCGAAGTCCATGGCTCTCGCTCGCTCTCTCTCGGAGGCTGGCTATAGAAGGAGAGGATGGAAGGGGAGCGATGGCTTTT
page-top