Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10898  (registered. 2003)
Contig Information
Length 868 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_PCDAM Anther at meiosis 1
Homology (BLAST) Top Hit hypothetical protein OsJ_015925 [Oryza sativa (japonica cultivar-group)]
Score 968
Evalue 6.48626e-103
Total Hit Count 398
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10898
TTTTTTTTTTCCACCTAACAACGCAGTTAATTAATAGTAGTAGTATATAGTGCGTATTATTATGGTCAAAGCCATTCACCCAACCAGCTGCCTCTGGTAA
CCCTACACTACTAAAGTCGATCAATGCCGAGAAGCTGGGTCGAATCAAGGCCCCTGCGTGAGCCTCTGCAGCTGGCTCGTGTCGCCCAGCGTCTCCATGA
GCAGCGGGGGAGCGTACTGCGCCTCCCCGTCGTGCTCCTCCGCGTCCTGGCAGAAGGACAGGATTATCGTCTCCACCGACGTCTCCACCACCCCGAAGAA
GAGCTGCGCCACCACGTACCCAAGCGCCCAGCACAGCAGCACGGGGAAGAGCGGGGACGATATCTTGTTGTGAGCAGACCTGTACTTGTGGGTGTCCAGC
ATGAGGAACGCGAACAGCGCGCTGGACAGGCTCACGCACAGCTTTCCGAGGTAGAGGATCACGTCCCCGATGACGTTCACCTTACCGATGCGCAGTATGT
TGTTCATTATCAGCCCGGTCGCGAGCTCGGAGGCTTTGCAGAACCCTTTCCCTGTAACGGCAATCACGATATAAGCATTCCGGTTCACTGACTTGATGGT
CCAGTCTATGCAGCCCAAGCAGCAGTGAGATGAGGATGACACTGTCTTCCCCAAGCGGCTTTCACCAGTTGAATCAACCCCCTTCAGCCTACGGCGGAGC
GATTTAAGTATACACCGCACCCACTCCACGCTGGATACGATCAGTGAACCTAGAGCCACAGATCCAAGGCTGTAGCGCAGCAAACGCTTCACGGAGGACA
CCACGGTATGAAATGGTATGTCATGCGATATTTCACCACGCGCCCAGTAGTATGAAGCAACTGATCCA
page-top