Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6432  (registered. 2012)
Contig Information
Length 1605 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_r Root 2
Wh_DPA20 Seed DPA20 3
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212721644|ref|NP_001132525.1|| hypothetical protein LOC100193988 [Zea mays]
Score 317
Evalue 2.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6432
CCGACGAATGCTCTAAAGCCCTCGAGCTACGTACACTCGTGACATCAACAATACCAAGTTTCAAAAAAAATTGAAATCCGCAATATTCAATACATACAAG
CTTACACAAAGACATGCTATCTTAACACAGACATCATCAGTTGCTCGTGCACAGCGACTCGCTCGTCCAAGCCCGGACCCTGCAGCAGAGGCTGTTGCTT
AAACTACCAGCACATACACCGCGTAGATGATCCCCGGTATGTACCCCAGTATGGTCAGCAAGAGACAGATCCAGAACTCCACGCCGAGTTTGTAGCGCAG
GAAGACGCCGACGGGAGGCAGGATGATGGCGAGGATCACCTCCAGGACTGTTGCCGAGCCCATGGCTTGCTCACTTCACTCGAGGCTTTCTGGCTTCTTT
CTTTCTCTCTGCTTTCCCTTCTGAAAGAGGCGACTGGTCGCAACGAGCGCAACCCTCGTGTTTAGTTGCCACTATGAGTTTGGAACCCTGAACAGACCGC
CGGTGTTAAGCCGGAGGAAGGAGAGGATGAGGCCAAGTCATCATGCCCCTTATGCCCTGGGCGACACACGTGCTACAATGGGCGGGACAAAGGGTCGCGA
TCTCGCGAGGGTGAGCTAACTCCAAAAACCCGTCCTCAGTTCGGATTGCAGGCTGCAACTCGCCTGCATGAAGCAGGAATCGCTAGTAATCGCCGGTCAG
CCATACGGCGGTGAATCCGTTCCCGGGCCTTGTACACACCGCCCGTCACACTATAGGAGCTGGCCATGTTTGAAGTCATTACCCTTAACCGTAAGACTAA
ACCTGCCCGACGCGACTGGCGGGGAGAGTGCGTGCGTACGTGAGCCCTAGCGGGTTTGAGGCAGCGCCGGCGGCGGAGATGTCGACGCCGTCGAGAAAGC
GCCTGATGCGGGACTTCAAGCGGCTGCAGCATGACCCACCGGCCGGGATCAGCGGCGCGCCGCACGACAACAACATCATGCTCTGGAACGCCGTCATCTT
CGGGCCGGATGATACGCCATGGGACGGAGGCACGTTCAAGCTTACCTTGCAGTTTACAGAAGATTACCCCAACAAGCCGCCAACTGTTCGTTTTGTCTCT
AGGATGTTTCACCCAAATATTTATGCAGATGGGAGCATCTGCTTGGATATTCTACAGAACCAGTGGAGCCCTATATATGACGTTGCTGCCATATTGACTT
CTATTCAGTCCTTGCTGTGTGATCCAAACCCCAACTCTCCAGCAAATTCGGAAGCTGCCAGAATGTTCAGCGAGAACAAGCGAGAGTACAACCGCAAAGT
CCGCGAGATCGTGGAGCAGAGCTGGACTGCTGACTAAGGCAGGGCGAGGCGGCGGCTGCCAGAAAGTTGCAATAAGCAACCATGAAACCTTTGTTTATGG
CTCTCTATAGTTGGTTCTTAGATGAAATATTAAACATCTCCAGTGATTGCTTGCAGGTCAAACCGTCAAAGTATCTTTAGTCTCCGTGGTAATTTTGTGT
TATGTCTCGTGGTACTGTTCTCATATGTTGTGTTGATCCTGCCTCATGAATTTAGGGGCATCCTATGTAAAAAGTTATAGCGTGGAAATGGTTGATGAAT
ACTTG
page-top