Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10876  (registered. 2003)
Contig Information
Length 1095 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsI_36791 [Oryza sativa Indica Group]
Score 771
Evalue 1.17929e-125
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10876
TTGGAAGACCAAATGTTGGGAAAAGTAGCATTCTAAATGCTTTGGTTGGAGAAGATAGAACTATTGTGAGCCCAGTTAGTGGTACCACCCGTGATGCCAT
TGATACTGAGTTAACCATAAAGGATGGGCAGAAATACAAACTCATCGATACGGCTGGCATCCGACGGAGAGCAGCAGTTGCTTCTGCTGGCAGCACAACT
GAAACACTTTCAGTAAAACGTGCATTTAGTGCAATTCGTCGATCTGATGTAGTTGCCCTTGTTATTGAAGCGATGGCCTGTGTCTCGGAGCAGGTATTTA
TCTCAACAATCCATTCACATGCGCGCACAAACATTTCATGTAGATACATAGTTTACTGTAACACCGTGTTTTTTTTTGCGGTACCAAGGATTATAAAATT
GCAGAAAGGATTGAGAAAGAGGGAAAGGCATGTGTCATTGTTGTGAACAAATGGGACACAATCCCAAACAAGAACAATGAGAGTACTACACATTATGAAC
AAGATGTAAGAGAGAAGCTTCGTGTACTTGACTGGGCACCTATTGTTTACTGTTCTGCGATAAATGGGAACAGCGTTGAAAAGATTATTTCTGCTGCTTC
TTTGGTTGAAAAGGAAAGGTCTAGAAGACTTGGCACCTCTATTCTTAACCAAGTGGTTAGAGAAGCTGTAGCATTCAAAGCACCACCACGAACAAGAGGT
GGCAAAAGAGGCCGTGTTTATTACACAACACAGGCTGCTGTTCGTCCACCAACGTTTGTCCTCTTCGTTAATGACGCAAAACTCTTCCCTGAGCCGTATC
GGCGGTACATGCACAAGCAGCTCCGGTCTGACGCCGGATTCCCGGGCACGCCTATTCGCCTACTGTGGCGTAGCAGGAAGCGGACTGATAGGCAACAGAG
GAGATCAAATACGGAGGCTCGTGGTGCGCTTGTAGCGGCGAGTTAGCATGTGAAGCAATGTTGCTACGTTCGAAAAGAAAAGGAAAATGTGGCGGAGTTA
GCAGTACCACGGCATCCCTTTTCCTCCTTGTTCACGCGCTTTTCCTGGCTGCGAACGTGTGACTAGCAATGCGCCAATGAGGTTCATATTATTCA
page-top