Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6427  (registered. 2012)
Contig Information
Length 1038 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226497512|ref|NP_001145607.1|| hypothetical protein LOC100279085 [Zea mays]
Score 389
Evalue 2.00E-106
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6427
TTTTTTTTTTCCTGCCAATATTTTGGCCATGACAAAAAAACTTGGTCTTTGCAGAGACGGATCTGCATAGAGCTCAACAAGGGCCAGGGCCCCCACCAAA
GTTTACAAATCTCACGAGAGTTTGCTTGCATTTTTCAAGGAAAAATGCTTAAAGTTTTCAGATCTACTATTACACAAGAAGTACCATCACTCCACTGATT
TGCCCCCACTCCAGTTTGCACTTCTCTCCAATCAATGGCAGAATTTGTGGCCTGTCGCTCCAGCGAGGATCCATGCATCCCCCCGATGTAACTCACAATC
TATGGCCCTCTGCCGCCGTAGAAATATCTTATTTGTCTCAAGGGAAACAGCACACGGAGCTTTCTTCTCAATACTTTCATCAGCCGGCTAATTACTTGTG
TATTTTCTAATTTACGTCAATCGGTGGCCGTTGTTTGTGGTGATCGGTGACAGACTGGTACGCCATCGCCAGCGCTAGAGCAATGTGGTCATGGTCAGGG
GGAGCATATATACCCGTCGTCACTGTGGTTCGTCTCCTTGTGTTGCCTTTTGGTGGGTGTTCGATGCTCTTGAAGCCCGTAGGCACCACGACGATGGGCA
ACCCCACGAGGTTTCCCAGACAAACGAGCTCCCAGTCGGTCACATTACCGATGAACGCGTCAACCGTGAAGCTCTCCCGGACCTCCCTGATCAGCCTACC
CCGCGCTCTCTGTGCCTGTACATAGTCGACTGCTGGGACTAATCGTGCACGACGAAGCTCCACCGGCCATTGATCTTGAGCTTCATAGTCATCGTCGTGT
CCTTCGCGTTGCCAGTTGTCAAAATGTGCAAGCATATCGACGTCCATCGTGATGTTTAGAATGGATTGAACTGATTCGACAGTGTAGTTCAACTTGAAAG
GCACAAACTTAGCGCCCTTGGCGGAAAGGACCTTGACAACCTCCATCTCAGCGCTGTCAAGATATCCAACAGTGAGTTTTGTGATGTCGACATGAAATGG
GTCCTCTAAAGCAATTTCACGAGACGAGGGATCACCAG
page-top