Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6424  (registered. 2012)
Contig Information
Length 766 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23Ž 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|2493650|sp|Q43831.1|RUBB_SECCE|RUBB_SECCE RecName: Full=RuBisCO large subunit-binding protein subunit beta,"
Score 376
Evalue 2.00E-102
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6424
ACATCAAGAAATTTCCGCTAAATGTTTCTCTGCTTATTTCGCCTTTCTGGCGGCACATCGCATTGCATTTTTTTTCTTCCTTGTCTCGAAACTACATCAT
CATCATCAATCTCTCAAAACTTGGTTCATGCTACCAAAAATTAAACCACATCCTTCGGAGAAACTCGGCCATGTCGCTCATCAGTATCCGAAGCCAGAGT
TGTCCATGGGGTTGGCGAGGGGCGCGGCCTCGGGCTCCTTGATCTCGACGACCACCACGTCTGACGTCAGGAAGGTCTTGGCCACCGACGCAGCATGCTC
CAGGCAACATCTCACCACCTTAGTGGGGTCGATGATACCAGCAGCCATCAAGTCCTCGTACTGCCCAGTGGCAGCGTTGTAGCCAAACTTGAAGTTGTCG
TTAGAAAGAACCTTCTCGGTGACAACACTGCCATTGACACCGGCATTCTTGGCGATCAACTTGAGTGGGTAGCACAGCGCCCTCCTCACTATCTCAGCTC
CAACCTTCTGCTCGTCGTTATCGAGGGTGTCCTTGATGGCATCAACCTTAGCAGCCAGCCTCAAAAGAGTGCACCCTCCACCAACAACAATACCTTCCTC
AACAGCAGCCTTGGTTGCGTTTAGAGCATCCTCAACTCTCAACTTCTTCTCCTTAAGTTCAGTTTCTGTTTGTGCTCCCACCTGAATAACAGCAACACCA
CCGGCGAGCTTTGCAATCCTCTCGTTGAGTTTTTCCTTCTCGTAGTCTTGTTCTGCTGCCTCAATG
page-top