Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10769  (registered. 2003)
Contig Information
Length 643 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit RecName: Full=Histone H2B.2
Score 447
Evalue 9.32292e-43
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10769
CATATCCTGAAACATTTGTGCCCTCACAAATTACAAGATGCTGCGCTTCTGAACATCTAACTACAGAGCACAGTGGATTCATCAAACACCCACGAGATGT
CAACACATTCAGAGAAGACACAAGAGCAGGCTATCTAAGAGGAGGTGAACTTGGTGACTGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCGCC
GGGGAGGACGAGGCGGACGGAGGTCTGGATCTCCCGGGACGTGATGGTGGGCTTCTTGTTGTACCTGGCCAGCTTGGCGGACTCGCCGGCGAGCTTCTCG
AAGATGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGGAGGAGATGCCGATGTCGGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATCTTGT
ACGTCTCCACGCTCTTCTTGGACTTCTTCTTGCCCTTCTTCTCGCCGCCCTCCTTGGACGCCGGTGGCCTCTTCTCGGCCTTGGTCTTCTTTGCCGTCGT
GGTCTTCTCGGCCTTCTCCGCCACCGGCTTCTTCTCCGCCTTAGGGGCCATGGATGCCGCTGCCGCTGCTGCTGCTTCGCCGGGGAAAGCTGCGGTGGTG
TTTTCNCTGGGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
page-top