Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6416  (registered. 2012)
Contig Information
Length 813 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242043224|ref|XP_002459483.1|| hypothetical protein SORBIDRAFT_02g005370 [Sorghum bicolor]
Score 331
Evalue 7.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6416
TGTATATTTATTACATGTACATTTATTCACAGACGGAGGGAGTAGATATCATCCTCGCGTGGATGTATGTCCACTCGTGATTTATCGAATAGATAGATTC
ATAATGAAATGGAAAAACGACCGGTGGGAATCCAACTCTACTTTTTAAGCTGCAGATGTTACAGCCGCTGCGGTCGTCCGTGCGAGCCTGAGGAGGCTGC
TCGCCGCATCGGTTCCGGTGGCGGCGGCGGCGGTGGCGTCGTCAGCGAAGCAGTGCGAGGGTGCCTGCCAGTGGGAGTCCTCTAGCACCCCGCCCACCTC
GAAGCTCATCACATGCTGCTGCATCCCATTGAAGAAGTTCCAGCGGACGGGGCGGTGGGTGAGGACGTCCTCGTAGTACCAGACGAAATCGACCTTGGTC
CAGAGGTGGCAGTCGAAGCCGTCGGTGCTCTCGCGGCCGAGGTAGACGGCGCCGTGGAGCCAGTCCGGGGGCAGGACGCCGACGGGGAAGCGTATGGTGC
GGCAGGAGGCGGAGTCGAAGATGTAGGAGGTGCCGTTGGTCCACTCCACGTCGTAGGTGGGGTCGCCGGAGAGCTGGTTGTGGATGAGGTTCAGGTTGCG
GCCGCGGGGCCAGTCGTAGTAGAGGTCGATGAGCTGCAGGCGCCCGCCGCTCTCGGTCAGGTTGGTGAACATCACCGCGTGGAACTGCTCCGGCCACGGC
GTCGGGACCAGGGGAGCACTGCCGCCTGCTGCCGCCGGGTTGGGAGGGACGGCCTCGGCGGCCACGGCGAGGAGCGGCAGCAGGAGGAGGAGGAGGAGCG
GCGGCGCCATTGG
page-top