Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10719  (registered. 2003)
Contig Information
Length 893 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 1
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194708104|gb|ACF88136.1| unknown [Zea mays]
Score 875
Evalue 5.95897e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10719
TTTCACCTTCAAAGGCATTGTTCTTATTTATCCTTTCTGTGACATTACACATTCTGCGAACAGAGAAAATAAAGTAAACAGGCTGACATCCCCACAACGC
TATACTAAAGCTGGAAGTCGATCTTAATGGGAAACAACACTGGGAATGACTAATGCACATACACTCTCATCAGTTTAACAAGTCTCGCAAGTTCCACATA
TATTAAGCTGTTTACAGTATGCACTAGAACAAAGACGCCACACAACATCGTTCCTAAAAGCATTTGTGAGCGGTGAGCTCACATGACGATCTCAGGCTTC
AGGATGCTTGACTTGATCTCCTTGTGTGGGAGAACAACACCGCCGTTGCTGTAGACCTCGTCACCTACATGTACGTCTTCTCCCAGGATAGTCATATTCT
CTATGCGTGCCCATTGTCCAACCGTCGAATGCCAGCCGATAATGCTGTTTGAGATGCACGCATGCTTCTTAATGCGCACACCGCGCATCACCGTGCATCG
GGAGAGCCTCACACCATCCTCCACGACGCATCCAGGTCCAATAGCAACATCAGGACCAATCAGGCAACCCTCCCCAATCTTGGCGCTCTCGTGCACCAGG
ACGTTCCCAACAACATGTGCTCCAGCGGCCAGCTTGGCAGCTGATTTCTTCCTAAGTGAATCTAGGTAGAGACGCAAGCCAGTGATGTAGTCCCTTGGCT
GGCCAATATCCATCCAAAAGCCTGGAAGGACCATGGCGTAGAGCTTCTGATCAGCTGCAATTCGAGGGAAGACCTCCTTCTCGATTGAAGTTGGCTTTAN
CTCGATGCGGTCCAGCACAGACGGATTTAACAAGTAATTCCTGCATTGATCTTGTTGCCTACAAATATCTTTGGCTTCTCTACAAATCTTTCC
page-top