Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10676  (registered. 2003)
Contig Information
Length 809 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_OKCS Seed DPA5 1
Homology (BLAST) Top Hit Os03g0861100 [Oryza sativa (japonica cultivar-group)] >gi|108712232|gb|ABG00027.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113550449|dbj|BAF13892.1| Os03g0861100 [Oryza sativa (japonica cultivar-group)] >gi|215713592|dbj|BAG94729.1| unnamed protein product [Oryza sativa Japonica Group]
Score 516
Evalue 1.47794e-50
Total Hit Count 395
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10676
TGGAAGAAGTGCAGAGAGCGAAACTCGCAGCGATGACCGAATGGAGAATCCCAGTCTGGAACAGGAGTATGTTGCCATCAGGGCTCCACCTTCTCCCGTT
GATCTTCCTGAAGATGCAAATCCTACCATCCATGCATCTGACAGCCAGTTGAATTCCTACGAGGTGGATGTGCCTGAGTACAAGAAGGATGAGCTTGAGA
AACCAGCCCCGTTGGCTCCGATGGAGGAGAAACCTTATGAGGCCCCTTTTGCCAGGGTAACATCATTGGAGGATGCTTCAAGCAAGACTCCTGCTTACAA
CCACCACTCGTTACCTGCGCAGGAACCCGAGACACTTGCGCGCGCAGCGAGCGTGAGGGCACGCGTGCCTGAGCCTGCTGCATATGCAGTCTCAGCCGAG
GAGACACATGGAGAAAATGGCAAGCCTCGAAGCAAAGAACCGAAAGGCTTCAGGAAACTGCTGAAATTCGGCAAGAAGAGCCACACCTCAACGATGGATT
CCGATGCATCGTCGGTCGACGAAGCCCCTGCAGGAGATGGTTCGATGCTGAAAAACCTCATTTCGCAAGACGACTCCGCGGGCTCTTCATACAAAGCTTC
TCGGTCCTTCTCCCTGCTGGCGCCGTTCCGCAAGAACAAGGTGGTCGTGCTGTGAGGATTTTCTTGTACTATTTTTGTTGTTGTTGATGAGGCCGGCCAA
CAGCTTGATTGGGTATCGATTGAGATTATTAGTTTGTTGATTTCTTCTAGTAAATACATACGTACGTGCATACTATTTCGTATATATATACTTGCACTGT
ACGCTGGTC
page-top