Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10607  (registered. 2003)
Contig Information
Length 866 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Homology (BLAST) Top Hit gtk16 protein [Zea mays]
Score 602
Evalue 1.77545e-60
Total Hit Count 387
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10607
CGGGCACTCCGGGGTGTGGCTCTGGTTGTCTTTGCTGCCTCTGCTGGTGCTTCTTCATGCTTTTTCCTGTCAAAGATGATTGGAAAACCGCTGGTGTTCG
TGCTGTGGCCAGACAAGCTCACATTCTTCCAGAAGCAGGTCGCCAAAAGAAGAGAAAAGCTGTTGAATTACATGCTTTTCCTCAGGGTCACCCCAACATT
GCCAAATACATTCATCAACTTGGCATCGCCCATTGTTGATGTGCCCTTCCATACCTTCTTATTGGCAACTCTTATCGGTCTCATCCCAGCAGCCTACGTG
ACCGTGAGGGCTGGGATTGCTCTGGGAGAGCTAACATCGCTCAGCGACCTGTATGACACCCAGTCAGTAGCCCTGCTTTTCTTGATCGGCGTGGTCTCGG
TCACACCAGCATTGTTGAGCAAGGACGAGGCGCAAGACACGGCACCAGAAATCGCAGCAGGCGCCTCATGAACACCGAAGAGGAGTCACCTAGCCCACCT
GTACATACCAAGGCACAGCATGCGGCGGCTTCATTGGATTTGGGCCATACAGGCCTTGTGAGGTGGATGACACATGGTCTGCGAGTTCACACGACGACAC
AGCAGCACGGCGGGACCTTGGACCCCAAGTCTGCCCGTCACCCGCCTGCTGGAGATCTGCGTCGCCACGAGAACACTATTTCATTTCATGGTCACCCCCA
CATTGTTTGTTATGAATGAATCTGGGAAGCACAATGCCCATCCACAGGCAAGATGCTTCGGATGTGTAGACAAGTAGCGTGTGTGCCGTTCGTCAGCCCG
CGATGCTGTTTATTTAGATGGAACTGGCAGCTAGTCCAAATCCTTGTGTATATATGACCAGATCAT
page-top