Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig640  (registered. 2012)
Contig Information
Length 994 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32400764|gb|AAP80614.1|AF470353_1|AF470353_1 beta amylase [Triticum aestivum]
Score 187
Evalue 2.00E-45
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig640
AGTATGGTGTTGTAAGCAGTTGGATCATATCGAGGAAGTGCATTTTCGCATGCCATATTTAGGCCCTCTCTCCATCCAGCACTCAACACCTGTTGGACTA
GTTCTTCCGGTGCGCTCATGGCCTGTGAGCTTTGCTCCGAGTCCCTCATCTCGGCGCAAGTGAAGTTAAGACTAGCACGGTGCCTTTTGAGCATGCGTGC
TATGGGTCTGTAGCCATCTCTATCATGTAAGTTGTAGTACCCAGCTGTGATCTCGGCTGCATGGCTTGGAACGGCACGAGGTTTTAGAGATATAATAACA
TGATACCATGTCACACAATATCACAGCGTACGATAGCATAGTGCTAGCTAGCCAAACTGCAGGGGTCATAATTAAACATAAAACAAGCTGGGCGGCCATC
TTTGGTTCTCATTTTTCCACCTCGTCTTCACACGTTTTCCTTGGTAACGGCCTGGGCTACGCTTCTAGCCCACTGCCAGAGAAAGCAGTAGCAGCAGCCA
CATACACAACTGTCACCTTGAAAGATCCATAGACCAAACTCTTCAACGCACGGTCGATGGATATCATGCGCTGCTGAAAGACACTTGGTTTCTTCTTTTT
TTGAAGCTCGTCCAACCTCTTTAGCGTCTCATTGAACCCCGCCCAGCAGTCATCCTCTTTCTTCTGGATGTTGCGAGCATGCTCGCCAGAGAGCTGGCGG
GAGCGCATGAGGCTGCCTGGCTCGAGGAGGTGTCGCTCCGCCACCTGCGATCGCTCGCCGGAGACCTTGGTGGAGAGCTGGCGGGAGCGCATGAGCCTGC
TTGGCACGAGCAGGCGTCCCTCCTCCGCGACCGCCGCCTGCGTTCGCTGGAGCAGAGAGCCGCCGAGCCTCCTCGCCGCGCACCGAACCGCCGCCATCGT
CGCCGGCCTTGGGGATCTTGGCGTTCCTCGCGCGGCTAGGGTTCGTCGTTCGCCTTCGCCGAGAAGAAAGACAGACGGGGAAAGTTCCTCGTGC
page-top