Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10480  (registered. 2003)
Contig Information
Length 1000 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 1
Homology (BLAST) Top Hit Os02g0832800 [Oryza sativa (japonica cultivar-group)] >gi|20372917|emb|CAD30022.1| N-acetylglucosaminyltransferase 1 [Oryza sativa] >gi|48716410|dbj|BAD23019.1| N-acetylglucosaminyltransferase I-like protein [Oryza sativa Japonica Group] >gi|50251412|dbj|BAD28450.1| N-acetylglucosaminyltransferase I-like protein [Oryza sativa Japonica Group] >gi|113538162|dbj|BAF10545.1| Os02g0832800 [Oryza sativa (japonica cultivar-group)] >gi|215715352|dbj|BAG95103.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1057
Evalue 3.94564e-113
Total Hit Count 191
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10480
GTAAGTAGTAAACACACAGACGCAAACTTGAATACAAACTCTTTTACTAACTACAACACACACATGGATGAATGAATCCCAGCCAAATAATGTACCTCTG
TGAATACATCTCTACACCGCGCGCTCTTCTTCCCTTACTCTCTTACTCTACTCTATCCCCTCCTCGACTGTCGACGGACGGCGAAACCCCTCGAGACCTC
GGCTCGAGGGCGAAATAAACACCCGTCGTCCATCCATCATAAAAGGAAAAAATATCCTTGCCAACAGTGCATTGAATTTGCACCCATCATTCAATGTTTT
GCTACATCAGGGTGTCACCTTCCCCACGTCGACACATTTCCCAACCTTGGCAACGCTAAGCTAAACGCCGAGTTGGCGAAGAGAGTCGGGGCCCACCAGG
TATATCCGTCTTTGGCTGCTCTTGTACCGGAACACCACCACGCCTTTGTAAGCCGCCCGTGGAACACCGTCCTTCCACTCTTCAAATATTCCAAACTGAC
GAGCTATACGCTCGAAGTCGCCCTGATTGTCATACTGAATCCTTACGTCCACATCCAGATTGTGGGCCTTCAACAAAGCATCGGATCCATGCACAGGTGT
GGCGCTAGCCACGTCTTTCCCGAATTTGGTCAAAAACTTGTCCTCCTTGAGGTAGCTCAGGTCCTCGGAATTCCAGTCAATATGAGCATCATTTAACTTG
ATAGGTTTCAAGTATTGATCAAAGAATTGTCCCATGCTTGATCCATGCTCGCCAAAGTTGTATGTCCTGCATACTTCTGGCCGAATAAACTGCCGATCTC
TGTGTACCTCCTTTAGCCTCACCCAGTCATCCCAATAAGCTTTGGGCCACTTTGGCGACAGCTCCATCCATGTTGACTTCGTTAGCATCCATCCAAGCCC
CGGAAAGAAGTCCGAACGGTAAAGAGCCTTTGGGTCATAAACGAACTGCTTTTGCCCATTATCATTCCAAGATGAAACAGCCATTATTGTCTTGTCAGTG
page-top