Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10386  (registered. 2003)
Contig Information
Length 706 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Homology (BLAST) Top Hit hypothetical protein OsI_39176 [Oryza sativa Indica Group]
Score 497
Evalue 1.82146e-48
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10386
TTTTTTTTTTGAAGAACTGACGATGATTCAGGATGGGTTCCTGCTGCAATGTCACCCCAAGATCTCTGAAGTTTTATAAACTCCCGTACACTTAAATGAA
TCACCCCTTGCAATATTGCACATATTGCAAGTCTTACACTTCTATGTGCACAAATTTACTATTTACATTCCTCCAACGAGCCACATATATATGATGATGC
TATATCTACAAATTGCAATGTACACAGCTTCAGAATTTGTTGAATTCTTCAGATCCCATGCCCTGCCTTGCCATGCAGGATGCAGCAGCGACAGTGGGGG
AAGATCCCTCCTATCAGGGTGGTGCTCGAGGTTTCCGTGAGATGGATCCCGGATCATATATATGATCTCTCAAGGATGCTCTGCGACAGTATCTATCTAG
GCCACAAACGCTGACGAAGAGGAAGAACCGTATATCTCGTTTGCCTGAGCCAGGGAGACGTACACGACATCCGTCAGCAAGCTGTGGGTCCGGCCGTAGA
AAATGTACACGAAGACCCCCATCACCAGCCATACCCCGACCCGCATCCACGTGCCACCCCCTAGATTTATGAGCAAGTATGTGTTTATGAGAATGCACAT
CACCGGCAGCAGCGGAACAAACGGGCAGATGAATCCTCCAGAGTGACCAAATGAGTGCCTTCCGTCGTCCTGGTCGATCCAGGAGAGCATTCCGAGACCA
GCTAGG
page-top