Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6376  (registered. 2012)
Contig Information
Length 1014 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115486269|ref|NP_001068278.1|| Os11g0615700 [Oryza sativa (japonica cultivar-group)]
Score 460
Evalue 1.00E-127
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6376
TTCTTTTTGGTGACACGTCTTAGTGCTACAAAGACATGACTGGACTGGGAGATGAGAATCAGATGCAACGCCCAAGCAGGCACTAATATCCCTTCAACAG
TAGGCAGACAACCCAAACCCACAACAGAGTTCATACGTTCATTGTGCTTTAGGGTTCATGGGAATACAAGAGGCTGTCTCACAAAGTGGCAATCCTTCAC
AACCTCGCGATGACCGCCTCAACCTCTGCAGGGGTGTAGAGGTGGTAGCTAGGGGAGACCTTCGCAATGTCAACGTTGTTCGGGGTCACCTTTTCTTCCA
TAACCTGCTTCAGGATAGAAAGGGCTATGGTCTCTGCCTCAGCGATGGTCAGTTCCTTGTTGTACTGCTCTTGTAATGAGCTATCAGCTCCTTCAGAGCC
CGACCCAATTGCCTTGGCATTGCACTGCCAGAAGGTCCCCGACGGGTCTGTGTAGTACATGCTGGGTCCATTTTCATCATGACCGGCAATAAGGAGAGAG
ACTCCAAACGGCCGTGACATTGATTCTTCATCACCTTCACCAAAGCGCAAAGCTAAGTCACAGATAGCTTGTGTGGTAGACTCTACTGTCATTGGCTCCC
CATATGAGAACCTATGATTCTGAGTCTCAACACGAGCATGCTCAACCAGTGTTCTGGCGTCAGCAATAAGGCCACTCATGGCACAGCCGACATGCTCATC
AATTTCCATGATTTTCTCCACACTGCTTGGTTCCAGCAGCGGTGAGGTGACACGTTTCTCAACAGCCAGTACAACACCATCCTTAGTCATCAAGCCGATT
GCAGTGGAGCCCAACTTGATGGCCTCAATGGCGTACTCGACCTGGAACAGCCGCCCCTCCGGGGAGAAGGTGTTGACCCCACGGTCGTACTCCGTCCTCG
TGAGAAACATCGCGTCGGCGGATGCGGATCGGAATTCGAAGCACTTGATTCTATTTCTACTACACGGGGTGGGTGCTTGGTGGGGTTTTTCTTGGGAACC
AAGTACTAGTAGAG
page-top