Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6374  (registered. 2012)
Contig Information
Length 967 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 2
WH_XV Leaves, plant was grown at constant 23 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|728594|emb|CAA88558.1|| glycine rich protein, RNA binding protein [Hordeum vulgare subsp."
Score 325
Evalue 5.00E-87
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6374
TTTTTTTTTTCGCAGCTATCACTTGCATTTTCTTCATCCATTTAAACTGAGTTCAAACATAGGATTCCAACATCACATCCCAATCCATGACAGAAGGGAT
TGCTGCATCACCGACGAACACGACCGACCGACCGACCGAAAGATAACACATGTTGTTTCTTCCTCGCGTAACCAGCTCTAATTAACCCCGGACAGAGCGA
CACTCGAGCTCGCGATCAAAAACACCACAGGACCGAACGACACACACGACTCAAGACTGACTGACACAGGAACACGACGACGACGACACTGAAGATAACT
TGCTGACGAAGACGACGAGATGGTAGATAGATCGATAACTGGAGGGCCCCGCCGCTCAGTTCCTCCACTGGCCGCCGGAGTCGCCGCCGCGCTGGCCGCC
GTAGCCGCCACCGCCGCCGCCGTAGCCGCCGCCGCCGCCGCCGTAGCTGCCGCCACCACGCTGGCCGCCGTAGCCACCACCGCCCTGGCCGTAGCCGCCA
CCGCCGCCCTGGCCGTAGCCGCCGCCGCCCTGGCCGCCGTAGCCGCCACCGCCGCCGCCGTAGCCTCCGCCACCGCCGCGCTGGCCGCCGTAGCCGCCGC
CGCCGCCCCCACCGCCGGAGCGGCGGGACTGGGCCTCGTTGACGGTGATGTTGCGCCCGTCGAGCTCCTTGCCGTTCATCTCCTCGATGGCCTGGCGCAT
CGACTCCTCGCTGCCGAACGTGACGAAGCCGAACCCACGGGACCTCCCCGTCTCGCGGTCGTTGATGATCTTGGCGTCGAGGATCTCGCCGTACTGGCTG
AAGGCCTGCTGGAGGTTGTTGTCGTCGGTGGCCCAGGCGAGGCCGCCCACGAAGCAGCGGTACTCCGTCTCCGCCATGGATCTCCCTTCCTCTCTACCGA
AACCCTAGACTAGGCTAGCTACTCGGCCTCTCTCTCGAACCGAACCCGAACCGAACCAGAACCCGAA
page-top