Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10278  (registered. 2003)
Contig Information
Length 1169 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Homology (BLAST) Top Hit hypothetical protein LOC100194019 [Zea mays] >gi|194694714|gb|ACF81441.1| unknown [Zea mays] >gi|195638322|gb|ACG38629.1| mTERF family protein [Zea mays]
Score 426
Evalue 6.89066e-59
Total Hit Count 147
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10278
TGGACGCTGTTAACTTTTTCTACAATAGACGGATTACATCTCTTCTTTTCATGAACGCGGTCATCCGTTAAACATGAAAACAGCTCCAAACATGATACAC
TCTGAATGTTGCACTAAACCCATGGCAGTGCTCATACAAGTTACTGCCTAGTGAGATGAGATCAGGGAGCTCTCACAAAAGAGAAAAAATAGAGACGAGA
CCAGGCAGCATGTCAATATGCATTGAGTAAAATAGACCAAAACACTATACTTGCCCTACAATAAAATGCCATACTCCGCGTCTGCGGCACTATAGCTCGA
TATACCATAGGCACCACGCCTAGTTATGCCTGCAACAAGTATGCATCGAAGCGGAGCTGATCCTCCTTCAGAATCACGTATAGGCAAACCCCCAGTTTGC
GCCATGCTCCATCTCCTCGAAGAAGAAAGGACCATGATACACATCCAGTTTCAGCACATTTTCTCCTCCAGCATTATCGCTTCTCACAGCCCGTTGTTGG
TTCATGTAAATCTGAATCTAGCGGGCACTTCCCCTCCACAAGCGGCAGCATAATCTTCTGCAAGGTGTGGTGCAGCCTCCTTGTGAGGGCATATGAACTT
ATCCATGAAATACTTCTCGCTCTCCTTGAAAACAGTATAGTAGCTCGGGTCGCGCTTGAGCAATCCATTTTCCTTGAGAAACTTTACAACGTGGTACCGG
GGTCTCATCCGGCCCTCTAGGCTGTAACAGACCATTGCCGGACGTTGAGTGAGGTAGGCCGGTTCCAACCCCACCTCAGAGATGAGGAATTCAGACCTGC
ACTGCAGTGATTCCTTTGATTTTACGATCAAATACGGAGCCTTACACACAGCAATGCTCACGTCGGCATCCGACCACCTGAATGTCTTCTTCAAGTAGTC
CCCCTCTGGCAGCGATCTTCTCCTCGGTGAAGGATGCAACAGCTTCTATCGCATACCTGAACATCCCGGATCCACGGGGTACACCGAGTGCTTCGGCGGA
CGCCAACGCCGCCTGGACGCGCTCTAGGTTGCTGCTGAGCAGCCGTGGCCTAGTGAGGCACAGCTTGGCAATATCACAAACACCTAGCCCACTCTCTTGC
AGGAGAGCGACGTTGGAGACGATGGATCTACGCCGGAAGAGGCTGGCTTTAACCGAGACGAGGCGCGCG
page-top