Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10232  (registered. 2003)
Contig Information
Length 1419 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsJ_034570 [Oryza sativa (japonica cultivar-group)]
Score 772
Evalue 6.48903e-142
Total Hit Count 177
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10232
TAGCAATAAGTCAACACCACTTACTGGAGACGACAGACGCCAAAAGGGCATGGATAAAAACTCGCAGTGAAATCGAAACTACTACTACTGCTAGGAGGAA
CCGAAATCTAGCCTTCAGTTGACACGCTGCCTCTTCTGGGGAACACCCTTGGACTGCTGGGGATTCAACTGCCGTTTTGCTTTCTCCCTCCGCCGCTGCC
TCTCGTCTTCGCTGTCGGATTCGCTGCCCATCTCCATGTCGGCATCCCTCGCCTTGCGCTCCATCTCGTCCCATGACTCGGCAGCGTCGTCGTCGTCGTC
GTCGTCATCTGAGCCAGCCGAGATAGCCTCATCCTCGCCAGAATCCACCACTGATTCGCTGTCGCTGTCTTCATCATCCGAATCAGAGGCTGACTCCGCT
TCAGAAGGTTCGTACTTGTCATCGTCTGTCTCAGAATCCTCTGAATCTGAGTCAGTAGCATCTGGATTCAAGAATTCCCACCTGTCATTTGTGTCACAAC
CTGGCTCGTCGAGCTTCTTGAGGACCATTCGCCAGTTGAGGTTCAGCTTTGATTCATAGTACTTCAAGTTGCTGTCATTAAGCCAATCTTTGATCTTGTC
AAGAGATGCCATTGGAATGACCTCTATGCGGACAACATCTCGCTTTAAATCTTGAAATACAAACACCATGTCAAAGGATTTCTGCCCCAGGGCCACCCTT
TCCAAGCATACTATCTCGACCTCCCTCAGCGAAGTCACAAGAAACGGTGATTCAACAAGCTGCACCAGGCAACTTGGAGTAGGAACTATAAAACAAGTTG
TTCTGCCATGGACTCCATTGAAGCCAAGCTTCTGCGATGGCCTTCCAAAAATGTAAGCCCGAGCTGCTGAAATCTTGGCTGCGACCAAACGGAAACAACC
CTTTTCACAAACAGCTCAAACTGTCCATTTATTTTCTTCCTTCGTGCCCTATCACGCTGCTCTTCCTCAATCTCATCAGGGTCCCGTGCTGAATGGCGCT
TAAGACCAACCGCGTCCACAACATCCATCACTTCAGTGTAGAACTGCACATCTCTAGTCTTCTTGTTGCCCACCATGATTTCATTGTACAGATGGAAGTG
GAGCAGCGTTATCATGTCTCTCTCAGCTGGCTGGAAGAAGGCATGTTTTATGTTGCTGAACATAATATCCACCTTTTCAGTTTTCGATGCAGAATATTGA
AAACCATTGACATGGGCCACCAAAGTTCCAGCGACCTTCCGCCCACGGCCACCAAACGATGGCCGTATCCACAAATCAGGAAACTGAATCCTATCCCTGC
TCATTCCGTCACATAGTTGAAGCCTTTCCTGACTAACCAAGCTCGCTCTCCTAGCTCTTTCGGTGACTCCTTTTTGAACAGTCTTCACCGATTTAATAAC
CTCTTCAGCATGACTTCTG
page-top