Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10195  (registered. 2003)
Contig Information
Length 870 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit Os06g0665000 [Oryza sativa (japonica cultivar-group)] >gi|52076505|dbj|BAD45383.1| LEM3-like [Oryza sativa Japonica Group] >gi|113596342|dbj|BAF20216.1| Os06g0665000 [Oryza sativa (japonica cultivar-group)] >gi|125556387|gb|EAZ01993.1| hypothetical protein OsI_24025 [Oryza sativa Indica Group] >gi|215740850|dbj|BAG97006.1| unnamed protein product [Oryza sativa Japonica Group]
Score 696
Evalue 2.26459e-71
Total Hit Count 320
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10195
ATCTGCTGCCTTATTACCAGACTTTGGGTGCCCAAAGGCATGCACGGTCTCGAATCTCATATAGGGTCAACAAGCCATTACATTACAGGATGGTTAATAA
ATCCATACCACAAAATGAGAAACTTATACTCCCCCCGATCCAAAATAAGTGTCGCAGTTCTAAACTGGGGTTAGTTCAAAACTGCAACCCTTATTTTGGA
TCAGAGGTAGTAATACAATCCGTAGTAGTACTCAACAACAAGGATCGGCTGCTGTATGCATGCCCTACAACAACAAACAAAAGAACATAGATCCGTCTGT
TAACATTTACACACACAGGTGGTCTAAAGCTACTGGCAATCTCATGTATCATTTAGGGCATGATGATACATTTCACGTAGTCGAGGCGGGCATCAATCAT
ATGCCATATCGAGTTCGGAAACACCCTTAGCGGCCTGCGGGGTGCCTGTTCCAGGACAGGTAGTTGTGATCTCCCAGTTTCCTTGGCTTTATCAAGTATA
GCAAGGTGAATGCAAATGCCAAGAAAATACAGAGTCCACCAACTATGAGGTATGCAAATCCAAGAAAATCATTCTTTCCTCCAAGCCAGGTTGCAGTGGA
AAGGACCAACTTCTTCTTGCCACCGAAGCTATATGTATTGTAGTTGTTACTCAGCCTCACTGTTATGGTATCATTCGCCTTGAGATCAACGTATATCCTC
CCATATAACTTTCTGAATGTAGGAAGCGCTGCAGTCCGCATCCAAACAATAAGATCCTCCTGTTCGCTCANCGGGATACTCNAGTTTANCTTCTTTCCAC
CTATGANCGCACCATTCTGGAAGTTGCTTGGGTAGACATTTTTGGCAAATTTGTGCTCCCTATCACTTTT
page-top