Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10141  (registered. 2003)
Contig Information
Length 814 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit glutathione s-transferase gstf2 [Oryza sativa (indica cultivar-group)]
Score 670
Evalue 2.08294e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10141
GGCCGTCAGTCAAACCGCTCTCCTGCAATCACGGGAAGGGGATCCATCATCCATGGCCATGGGGACGGAGGCGAAGGCGAAGGTGTTCGGGCCGGCGAGA
TCCACCTGCGTGGCGCGGGTGCTGGTGTGCCTGGAGGAGGTCGGCGCCGAGTACGAGCTGGTGCACGTTCACCTCCCCGCCGGCGACCACAAGGGCCCCG
CGCATCTCGCTCGCACCCCCTTTGGTCAGGTCCCGGCTTTCCAGGACGGCGATCTCATCCTTTTCGAATCGCGTGCGATTTCGAGGTACGTGCTCCGCAA
AGGCGCATCCGATCTTCTAAGGCAGAGAAGCCTCGCCGAGGCGGCGGCGGTCGACGCATGGCTCGACGCCGAGGCCCACAACTTTGACAGGGCCATGTCG
GCGATCACCTTCCAGTGCTTCGTCGTACCCATGTTCATGGGCGGGATGACCGACCAGAGGGTCGTCGAGGAGAACCTGGAGAAGCTTAAGGTGGCCCTCG
GAGTCTACGAGGAGCGTCTGACCAGGTTCAAATACTTGGCCGGAGATTTCATCAGCCTGGCGGACATCAGCCATTGCCCCATGGCTCACTACCTGCTGGC
CAGCCCCTGCGCGTCGGTGCTCGATGCGTATTTGCGTGTGAAGGCCTGGGTTGATGGGATGATGGATCAACCGAGCGTGAAGAAGGTCATGGAGCTTATG
GATGCGTCATGAAAAGAGTGGTGTGGTGTGTGCTTTGTGGAGACTATGTGAGATGTGCTGGTGCAGATGATTTGTCTTGTTTGTAATAACTCTTTCCATT
TCGAGAGAAAAGTT
page-top