Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10136  (registered. 2003)
Contig Information
Length 953 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 1
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit hypothetical protein OsI_13471 [Oryza sativa Indica Group]
Score 629
Evalue 1.54511e-63
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10136
TGTGTTGGGACACCTTGTTGGATGGCTCCAGAGGTTCTTCAGGCCATGCATGAGAAAACCCAGTATGGACTGGAAGTGGATATCTGGTCATATGGATGTT
TTATATTCGAGATGCTTACACTTCGTATACCCTACGAGGGACTACCAGATTCAGAAATATATGATCTCATAAAGAGGAAGAAACAAAGGCCAAGGCTAAC
TAAAGAATTAGAAGCGTTCTGGACAGTGGACGAGCCAATTACGAGGCTGAAGTTGGGGATCACATCTGATGCTCATGCAGAGAAACTGAGATTTCTAATT
GATCTATTCTACCAGTGCACCAGAGGAACCGCATCTAGGCGCCCCAAGGCCGAGCAAATTTACAATTCGCTTTGCTCCTTACCCACATGCTATGACCTGA
GCTGAACCTGTGGACCCTGAATGAGAAAGCTGATGGTGAGGCAGCCTTGCTGCCAGATTGGCCTAGGTCAGGACAGGTTAAACGGGACAGCTTATAGCAG
GTCGCTGGATCTGGCCAGCGTCCGAGTTCCTCGGGGCTCGGACCAGAACACTCCGCATTTCACTGATGTTGGTCTTCGGGTGGTGGCGGAAAAAGTCAAA
CCAAGGCGAGGGGTGACTTTGGCCGCGGAAGCTCCTCCTGGGTCAGTTTTGTAGCTGCACTGCATGCTGGCTTCACCTGTTGTAGCAGTCTCCATCCTGG
TCGTGTGTGTATGTGTATGTCATGTAATATTTTTCTTCATAGTAATTTCCAATTTTCCATAACTTATTATTCAATCGAGTCTTCTAAGTTATCGATTTTA
GGTCAAGGCTCCATTTTTATGTATCTGTGTACGTAAGATTGTTGGTCCAGCGGTGATCCATGTAACTTTAGAATGCTGAGTTGTGTAACAAACGGGAACG
GGACAATTTTTTAACAGAGGCTGTGTGTTATGATTTCCCTGCCAAAAAAAAAA
page-top