Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6356  (registered. 2012)
Contig Information
Length 1287 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_SP 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23℃ 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig6356
GCACGAGGCTCGATTCTTCCTCTCCCTCTCACTGTCCTCATCTTCATTCGCCACCGCTGGGTCCTGCCGCGAAGCTTCCCGCCGTCCGTGCGCTTCGATG
CTGCGCTGGAGGAGGCACTGTCGTGCTCGCCTGTGCAAGGTGCGGGCTTTGCCAGGCAGGGCTCGCTGCTCTCCAAGGGGCGGCAGGCGACAGCCACCGG
TGACACCGTGTGTCACGCATTTTCAACTTGTACACTGGTAAATTTGTTTGAGGAGTGTGGCCGGTGATCCAAGCCGGCTAGCTTCATACTGTATTGACGG
ATTTTCTATTCCTCAAGGGGCCGTCGTCCTCCTGACGATTGGATTGTACTTCTTCCTGCTGTTCCCTTCCTCTGGTTGTTGATGCCTCAAAGCAGCCGCT
GCTTGTGTGCTTAAGTTGTTCCTTTAGCCTTCCATTGAGTTTAATCTGTTCCCTTCTCTGCTTGTTGCTGCATCAAGCAACCGCCGTATATAAATTGATT
CGATTGATTACAAAGGAGCGAGGTGGTACTATTTATTCTGATAATAAACATATTTCTTCTTCTTACAGCAAAAGCACGCAACCGCACTCGTTTCTATCCC
CCCCTTCGCAAATCCCCCCTTTTTGCCACTCCAGTAGCCCGGCCTCCCTGCCTCCGACCGCGCCTGGAGAGGAGCTCCAGCTGTGCCACGAGCAGGCCAA
CCCAGGAGCTGTCACTTCCCCCTCTCTCCTTCTCTCTCTCGACTTTTACCTTCTTCTTCTCTCTGTTTCTAATCTTTGTTTTCTATAGGGAAGTCACCAT
GGAACAACCCCGCCGCCTTGGAGCTCGGCCCGCCTCCGGCCGGCCACCTCTCCGTCGGCCTCGTGCTCCTCCGCCTCGATCCGTCCGCCCCATCGCCGTA
TCCGCGCCGGAGCAGCCGGATCCGCTGCCCAGACCACAACCAAGAGCCGCCTCTTGCCTGTCCTACGGTCGAGAGGAGGACGACCGAGAGGAGCGCCCAT
TGATCCGCCGCCTGGGCCGCCTTGGAGCACGCCCTGCCTCCGGCCGCCACCTCTCCGTCAGCCTCGCGCTACTCCGACATGATCCGTCTGCCCCACCGCC
GGATCCGCCGCCCAGACCACCAACCAAGCATCGGCCCTTCCCTTTCCTGCGGTCGTGGGTTGAATAATATAAACTGCAGGGTCCTTTTTTAAGAACAAAT
CGTTTTTTAGATTAGCCACTTTTTTGCAAAATCGCCGACGACGTACCAAAAAATGCCCGTGCGTTGCAACGGGAGAGATTTTTTTTT
page-top