Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6353  (registered. 2012)
Contig Information
Length 1885 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_SH - 2
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_SP 2
WH_XB Root 5
WH_XE Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222624938|gb|EEE59070.1|| hypothetical protein OsJ_10874 [Oryza sativa Japonica Group]
Score 960
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6353
TTTTTTTTTTTGAAACAAGAAGTATTTTCATGTGCTATGACATAGCAAGAAAAAATGTTCAGGCCGATATACAATTTATGCGGCACAAAATGTCCAGGTT
GAGTATCCCTAGAGGAAAATTCTGAAACCAAGAAACTAACAGTTTAAATACGGTGATCTAATAGTTATACAATAACAACACAATACAATTCACACTAACT
TCCATGGAACAGCACGCCTGTGTATGCTCATAACCGAATAATTTTGACGGAATACCGATCTTCAAGTTTCCCGTCACTTAATTGATAAGAGACTCCATAG
CTTCAAAGAATAGAGGCACAAACTCCCTGTTTGGAGTCTTGACTGCACACTTGGCACCAGGAACACCAACAGCAGCAGTAAGCTCTATCAGAAATGGAAT
CCCACGGGGGACCTTCGCAGACAGATACAGCACATCCATGTTTGCATTTTTCCGCTTGGCAATAAAGAACACATTTGATGCTGCAAGGTGTTCAACGGTG
GCATCTATGCTGCTGATGACAGAATTGGGGTATTCTTTTGAAAATTCATTGTCATCAGGTAAAGATTTCCAGGCCTCAAGAAAACTCGTCCGCTCCATTT
TGCCATCTTCACCAAAGAACACATGCAGCAAGCCTTTGTCGCTGAAATACCACACAGGTTGCTGATTATTCTTCACTGCAACCTGCAGTAACGAGTTTGG
TGCTCCAGGAGAGACATTCTGGGAGAAAACCATAGCTAGGAGCGTCCTGGCTGAGGACCCAGGTTGGAGTGGAGGAACCTGAAGTGGTCCACCGGCTGCA
AGACCAAATGTGTTCTTGTTAAACTGAATCATAAATCCATCTAATACACCATGGGTCCCATTCTCAAAAGATATATCATAGTATATCTGGCCATCCCGTC
GCACCAGTTGCGCACTGATCTGGAGACCTTGGCCAGTGGTTGAAGGCAATACAACAGGGAGTGGAGGTCCTGAAGATGCTTTAGGTTCGTCAACAGGAAC
CAGGGCATTATCCAAACCCATTAAATCACCTAGGAGATCTGGGATCGGAGCAGCAACTGCTGCGGCTGCAGCTGCCGGCTGCTTCACTGGTACATTTGAT
GAAGTGCCAGTACTAGAGGACGGTGATGCCCCATCCACTCCCTGAGATGGTGACTCCGAATACCCAGTTTCTCCAGCATCAGCAAACTCCTCATCATCCG
CCCTAGGAGCTGCCTTAACACGGCTAACAAAGGCTTCTGGGGGCTTGTGATAAACTGATGATAATGTAGAAATGTTTGCTAATAACTCATCAAGAAGCGA
AGAGTCAAGCTGGTTAGAGTCATCGCTGATCACAGGCTTCTCTGCCAGAACAACATCTTTTGCTGCCTCAGGATCAGTAGAAAGAAGTCGCCAGTATATG
TAAGCTCGATCACGCAGATCAGGATTGTCTGTTTCAACTGTGGCATTATTGAGAACAGCCTGTATCATCTGCTGGGGCCCCTCAGTTGGCTTCTTAAGAA
ACAACTTAACAGTCGCTGTTAGCAACTGCAGTTGAACTAATGCTGGTTCTTCTGGGAATGTATCCAAGAAACTCTCAAGGAGTTCATCAGCATTGTCAAT
TCTTTCGGCATATTCTCCAATTATCCAAATCATTGATGCCTTAGCCTCTGGTTCATCTAAAGTGTCCAAACTTTCACAAAGTGTTGCGATGATAGACTCA
TATGTGTTAGGATAGCGTCTAAAGATGTCTTTGATAACAATGATAGCTTCCTGTACGACATAATTAACCTTTATCTTGATCAGCTCAAGCAAGACACTGA
TGCACCTTTCAGCAGCTCTCTCCAATTTAATTGCACATCTTCCAATCGCACGTACAGCTTTCCTCACAAAGTCAACATCAACCTC
page-top