Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10100  (registered. 2003)
Contig Information
Length 552 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Homology (BLAST) Top Hit hypothetical protein AaeL_AAEL012905 [Aedes aegypti] >gi|108870667|gb|EAT34892.1| conserved hypothetical protein [Aedes aegypti]
Score 83
Evalue 1.03128
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10100
TTTTTTTTTTACAGTGTAAGGTGCATTAAAAATGACACTGCAAAATGCACTAAAATGACATTGTAAATCCACCAATAATCCAAATAGTTTGCTAAGATTA
AACATTAATAATTACAGTGTAATATTAAACATACAGACCACTACTAAAACCAAAAATACTGCTATGCTCAGCTTGATTGCTACTTGGCATTGCCTCACTT
GCTGAACCTCACTTGGATTACATGCTAGTAAAATAAGAACTCAGCCACCATTTGTGCTAGGACCGCGCACATTCTGAACCTCACTTGGCATTGCCTCCCG
AATCAGATGAACAAAAATCGGCAGGAGGCGGGAAATTGGGGCCGTGGTTGGTGCGGGGGGCGAGATATCCTGCAGACAACCGACGGGAGGTCGAGCGGGG
CGCGGAGGCAGCAGGGGAGTGGGACAAAGAGTGCAGATGAGTCACCAACAACCAACTGCATCGATCGCCAAGAGGGAGATCCAAATCGCCATTGCCATCT
CTCCCAACCTCTGTTCCAGGGGATGCCATGTGTGAAATGGCAAAGAGGAAAT
page-top