Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9962  (registered. 2003)
Contig Information
Length 813 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 1
Homology (BLAST) Top Hit Os03g0787200 [Oryza sativa (japonica cultivar-group)] >gi|50355734|gb|AAT75259.1| putative calmodulin-binding protein [Oryza sativa (japonica cultivar-group)] >gi|108711448|gb|ABF99243.1| IQ calmodulin-binding motif family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|108711449|gb|ABF99244.1| IQ calmodulin-binding motif family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549967|dbj|BAF13410.1| Os03g0787200 [Oryza sativa (japonica cultivar-group)] >gi|125588172|gb|EAZ28836.1| hypothetical protein OsJ_012319 [Oryza sativa (japonica cultivar-group)]
Score 209
Evalue 3.81076e-18
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9962
CATTTCAGAATTTTTATTGTACAAAAAATAGTCCCAGAAAATGTGAGTCCATACTTGCTCTTAGCTACAAATACAACAGTACAAGCTATGGTAACCTCCA
GGACTAGAGGCACCAGCTGACCAGCACATACATATCCAAGCACTAGCTAGATCTCATCTCATGAGATGAGCATTTGACTGCATACCTATAATATGGCTAA
GAAATAAATGCAAATTGCTCCAATGGACCTTCCAGAATCTAAGGCCGCCCATGTATCAGAGCGCAGCATGCTGACTTCGAACCTTGACGACGGTAGATAG
GGCTTCAGATGGCTTGTCAAGCCTGCAGCTCAACTCTCTTGAACAACAGATCAACGGAACCGGCACGGCGATGCTTCCCTTCCAGCGCTGGGGAGTCTTC
GGTAGCCTTGGGGGATCGGCTCACCGCAGGTTTATTCACTTGCCGTTTGCCAGTTTCTGTGCCAGTGCCAGGCAAGGAGAACCTCTTGTTGGCCCGTGGT
TGTAACTGTCCAGGCCTCTCCTTAGGATTACTACTGCTCCGGACACCAAGTCCCGAAAGACGAGACGAGACTTCATCAGAACCTTCTTTCGGTGGCAGCT
TCCGTTTCGGTTTAGCTGACGCCGAACCGGCAGACGGGTTCGACGAGGAGCCACCACCCTCTGAGTTCGAGGGCCGGGCCTTCTGGATCAACACATTTGA
ATGAAGAGCTGAAACCTGCTTTTTCACCAGGTTTCCTGTATGGGGCCTTGGTTGCATTTCCCTCAGCGTGCTGCGCTCCGGTATCGATGGCAATTCCATC
TGCTGCGTACATG
page-top