Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9960  (registered. 2003)
Contig Information
Length 815 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_SHDr Shoot grown with dessication 1
Homology (BLAST) Top Hit Os03g0841800 [Oryza sativa (japonica cultivar-group)] >gi|50428675|gb|AAT77026.1| putative protein kinase [Oryza sativa (japonica cultivar-group)] >gi|108712021|gb|ABF99816.1| Shaggy-related protein kinase kappa, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113550325|dbj|BAF13768.1| Os03g0841800 [Oryza sativa (japonica cultivar-group)] >gi|125546386|gb|EAY92525.1| hypothetical protein OsI_14264 [Oryza sativa Indica Group] >gi|215697754|dbj|BAG91748.1| unnamed protein product [Oryza sativa Japonica Group]
Score 565
Evalue 8.50577e-104
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9960
TGCATCAATTCATCCAAGCAAGAAACTTCCAGAAACCCCAAATCATCTATACACATCAACCATCAAGCCTGCAAACCTCACATGCACCCTGGGGCAACTC
TACTACACCAGTGCTTGCACCCACACAAAGCTACAGCTCAATTTACAAGCTTCCCTCCAGAGTCCAGGCACCAAACAACGCGAAAAAACACGGAGAGGAC
ATGCGAAAACTAGGTGCGGAGCGCCATGAACAGGTTCTGCTTTCTCGCATGCTCCGGAACCAGGCGCTCGACGACTTCCGGAGGTATACCGTTTAGCTCT
TGAGATCTGAAGTTGAAGAGGGGAGGAAGAGGGCGACCGTTAGGTAGACGGGTGTTTGGATCTCTCAACTCATCAAAGAACGGGTGCATGCAGGCTTCCA
TAGCAGTGCACCGAAGATCTGGCGAGTATTGGAGAAACCTGCTGACAAGGTCCATTGCTTCAGGTGGAAGCTTTTTCTGAAAACCTTGTGCCATGGGTGA
GCCTTAATTTGCGGGAACTTGAACTCCGTGTAGTTTGGATTCATGCACTTGATCTCTTCCCTTGTTGGAGTACCCAAGACCTTGATAATCTCAACCAGCT
GATCAACTCCACTTTCCCCAGGAAAAAGAGGCTGTCCAAGAAGCAGCTCTGCCATGACACAGCCTGTGGACCACAAATCAATGGCAGTTGTATATTCAGT
TGCACCAAATATGAGTTCTGGTGCTCGGTAGTATCTTGAGCATATGTAGGAGATATTTGGCTCTCCCTTGACCAACACTTTTGCACTGCCCAAAATCACA
TATTTTGAGCTGGTG
page-top