Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9957  (registered. 2003)
Contig Information
Length 967 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group]
Score 902
Evalue 1.27119e-96
Total Hit Count 55
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9957
GCTCCTAGCGCGCGACCATGGTCGGCGGCAGGCTACCCTAGATCGTGTACAGGGCGGTGTTCGCCGCGCTTGGCTGCCTCATGGATGGGCACCCTGGTGT
ACACCTGCATCACCGACGGCTCGCCGTTTCGCACCGAGCTGCTGACCCCGTGGATGGTGACAACACTGGTTGATCTTTATGTAAATATAGCAGCGATTTC
GACTTGGGTTGTCTACAAGGAAGGAAATTGGATTACTTCTATCTTCTGGGTAGTATTGTTGATTTGTTTCGGCAGTGCCACTACATGTGCTTATATTGTT
AGCAAGTTATTTGAGATAACATCTTCAGGGCTTTCCCAAAATCCGCTTGACCTTTTGTTGCTCAGGCAAAATAATCTACCTGAAAGGAAGTGTTCTTTTG
TCGTCATCGGAAGAACTATTTTCAGCATTCTGGGCATACTCATGGCTGCACTTGTCACGTATACTGTCATTACAGATGGACTGCCTTTCAGGAAGGATTT
GTTGACACCGTGGATGGCTGCAACCTTAATTGACTTCTATATAAATGTTTTTGCAATATCGGTATGGGTTGTTCACAGGGAGTCGACTTGGATCTCAGCA
GTCATTTGGATATGCTTGTTGATATGCTTCGGAAGCATCACAACATGTGGCTACATTGTGGTTCAACTTCTCCAAGTGTCATACCAAGACCCAGTCTACC
ATCTGCTACTGAACTCCCATAGCAAGTATGGAATCGCACCCTTGCAGTAATCGCCGATCCTCTTCTACTATCCTGGTTAGCTTACAGTTGGTGTAAATTC
TGCTCGACATGCAATCATTCATGTGGCATTTACCTGATTGAAATGTAGGAAGACCTGAAAACTCATTGAAGGGATATGTTCTTGGTACACAATAATGTCC
CCTCTGTTCATAAAGGTGCCACAATAAAGGGTATACCAGAGTAGCAATTAGAGAAGTTTTTTCTTTG
page-top