Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6337  (registered. 2012)
Contig Information
Length 490 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_SHC Shoot grown with cold treatment 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115450501|ref|NP_001048851.1|| Os03g0129900 [Oryza sativa (japonica cultivar-group)]
Score 141
Evalue 2.00E-32
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6337
TTCAAAACTTCAAGGTGTCATTTCACTCAACGAGTATAAACATCTAGTTCCTTATTGCATCATCACACTTAACAAGAAGAAAACTGGTAGGTGCTCGCAC
CAAAAGAGAAAAAAGGCAGGAGGAAACAAGACGGGAGTTAATTCAAACAGAACACATGTTTTGTTCATACAAGAACAACATTGATGATCCTTGCAAGCAC
CGCGCCCTTCGAGCTCCCATGACCAACCCATCCTGAATCTGACGGATCAGGCGAGCTTGGCGGTGGAGGGGGCAAGGGGCACGCCGATGGTGACGCTGCC
CTTGACCTTGGCGCCCGCCTGCGCCTCGCGGATCTTCTGCATCTGGAGCATCCGCTCCATGACGAGCTCGTACTGGCACTTCTCGTAGGAGTGGCGCTCG
GGCTCGCACTTCCAGGGGAGGTAGAACTCGGCGACGCGGCACTTGTTGAGCGGGATGAGGAGGTGCGCGCACTGGTCGCGATCCTCGTGC
page-top