Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6336  (registered. 2012)
Contig Information
Length 582 bp
Clones alternative view 61 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 5
Wh_h Spike at heading date 4
Wh_yd Spikelet at late flowering 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 5
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 4
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig6336
TTTTTTTTTTCGACACAAAATACCACGGCTGAGCGAGCCAAAGCTCACTCTTTGGTGACCATAGTTTTTTTTTTAAACAAAAGCACAGTTTCTTTCCTCT
GTGACGGAAAATAAATTTACATGATCATTCCCCTCCCATGGTGAGGGTTACATGCAACGCAAGAGGAAACCTACATCTGGATGGAAAATCAAACAAGGGA
TCACGAGGGTCTTGTATATTATTGGCTGGGTTGTCCAAACTCAGAGAATCATCCTGAAAATGTACGCATCAAAAGCTGTAGCCGTGCACCCCCATAGACA
CTTATGCCTCAGGCTCGGGCTTCTCGAAGAAGGTTTTCTTGATCCAGTCAAATGGCTGGACGAGGTAGATGGCGGCGCTGCCGGCGAAGATGCCCCAGGT
GGCGAGGGCGGTGACGTCCGTGGGCTGGATGCGGCGGGAGGAGAGGAAGCGGGAGAGGGTGGAGCTGGACGCCGGGAGAGCCATCGCCGCCGTTGATTCG
CGTCTCGTTGCTTTTCTCTCTCTCTCTTCTCGGGGGCAGGTGAGGAAATTGGGCGAGAGGAAGGCGGCACGAGGCCTCGTGC
page-top