Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9786  (registered. 2003)
Contig Information
Length 912 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit glutathione transferase F3 [Triticum aestivum]
Score 936
Evalue 3.63213e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9786
GACGATGGCGCCGGCGCTGAAGGTCTACGGATGGGCGGTCTCACCGTTCGTGGCACGCGCGCTGATCTGCCTGGAGGAAGCAGGCGTCGACTACGAGCTC
GTCCCCATGAAACGTGAGGCCGGCGACCACCTCCTGCCGGACTTCCTCGCCAGGAACCCCTTCGGCCAGGTCCCCGTTCTCGAGGACGGCGACCTCACCC
TCTTCGAATCGCGCGCAATCGCGAGGCACGTGCTTCGCAAGTACCAGCCGGAGCTGCTGGTGGGCGACGGCTCGCCGGAGTCGGCGGCGATGGTGGACGT
GTGGCTGGAGGTGGAGGCCCACCAGTACAATCCCTCGGCTGGTGCCATCTCGATCCAGTGCCTCCTCGTCCCGTTCCTCGGCGGCACGCGCGATCAGGCC
ATCGTCGACGAGAACGTCGTCAAGCTGAGGAAGGTGCTGGAGGTGTACGAGGCGCGGCTGTCGGCGTCCAAGTACCTCGCCGGGGAGTCGGTCAGCCTCG
CCGACCTCAGCCACTTCCCGCTCATGCACTACTTCATGGAGACGGAGTACGCGTCGCTGGTCGAGGAGCGCCCGCATGTCAAGGCGTGGTGGGAGGAGCT
GAAGGCCAGGCCGGCGGCGAGGAAGGTCACGGAGTTCATGTCGCCGGACTTTGGGATGGTGAAGAAAGCAGAGCAGTGATTGCAACGCTGGCGTTTATTA
TGTTGTGTACACCTATGGCGCGATGTCTTTAGAATTTAGATTGTTTATTATGGGGCGTGTTACGCGTGGCCGACGAAAGATCCGTCGCTTGAATAATCTT
GCGGCCATGCTTCGTCGTTTACTTTTGCAACAAAAATCTTGTTATGAAACCTTTTGTAATAGAAATTGTGTGGTAGAAATATTTGTAACAAGTTGTGTTG
CAAAAAAATGCA
page-top