Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9776  (registered. 2003)
Contig Information
Length 744 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit hypothetical protein OsI_26258 [Oryza sativa Indica Group]
Score 489
Evalue 1.71988e-47
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9776
GCTTGTAGTTCAGCTTTACTTCTGCTTTACCCTACACACAACAAACCATGGATGATCTGGTTAGCAGCTCATCTTTGAAGAGTGTCCTCAGCTGCAGTGA
AGCGGAGGCTCAGCCGGAGGAGAGTTCCTGGACCGATTACTTTGTGGATTTCATGATGTCCGAGGAGGAGAAGAAGAGGCAAGGGGCCTCGTATTGCACT
TTTGATCAGGAGGAGCTGGAGGAGGAGGAGGAGGGCTCTATGATCTCCGATGCCGCCTCCCTCGCTCCGGCGGCGTTGGCAGATAGGTACAAGGGGCTCA
AGAAGCTCAAGAAGAAAGTCTTCAAGGCCCTGGATCATGATGATTCCTTGGAGGATACTGCAAGCTCTCCTGTCAATAGCCCTAAGGTCAGTGCTTTGTC
ACAGCTAGAATTCAGCCCTAAAAGAAGGTGCAATGTTACGGACCTCGCCAAGGGGGCTGGGATTGGCAACGATTACGGGAGAGACGGAATGGACTGTGAA
GATGCAGATGCAGTGATGGAAGGAGTGAGCTTTCTGGATCAAAGCCAGAGGGGTATAACTCCATGTGCAGAGCTCAAGGACAAGGGGCTTTGTTTGGTTC
CGTTGTCCATGTTGCTGAACTACCAGGGCTAACTTTGAGACTTATATGGCCCTGTGTTTGGAATGCATTATTTTTTCCGAATCTTGTCGGAATTGGATTG
CTTCCTGAAATTCCTTCAAAATTTCCCGTGAAATCCCTGCGTCC
page-top