Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6317  (registered. 2012)
Contig Information
Length 1803 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
WH_SP 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473797|ref|NP_001060497.1|| Os07g0655500 [Oryza sativa (japonica cultivar-group)]
Score 716
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6317
TGAAGCATCATTTGGGACCTCTCGTCGTCATTCAGGGACAGAGAGAGCTCTGAATGACCCTTTACGGGATAATGAAGGAATGCTTGTAGATGAATATGGA
AGCAATACTGGTTTCCATCTTCCAAATTTGATCTGCGTGAAACTGCTGGACGAGGAAGGAAGCTCCTCTGAGGATAGGAGCTTTGAAGCTGTCACTCCTG
AACATGAATCTACTGGTGCTGAGCAAGGGGAGGGTTCTCAATTGGATGGGGCGAAGCATCGACTTGTCTTTGAAGAAGTGAATGGTGATCTTGAGATGGA
AGATGTAGCCCCATCATCTGAAGCGGAAGCTAGCTCTGCATGCCAACCAGATCTAACAGCTGCGAGGTGTACACCGACTAGTCAAAATGTTAATTCTGTT
CCTCCACTACCTGAAGACAAACCTCCAACTCCTCCCCCGTTGCCATCATCTCCACCACCTCTACCACGCCCTCAGTGTCCTGTCATTCAAGGTTCACAGG
TTCAAGGAGCATTGCATGTGGCACCTGATCGAGTCGAGCCAGATACTTTAAGAAATGTTCAAGATCAGCACCCTCATTCTATTGCAAATAATCGAGGCAA
CATGGATCCTTGTGCGGTTCCATTCCAGCCTCCACCGCCCTATACTTCTGGGTGTGCAGGGCATCCAAACCAGATGCATCCGCCGCCACCGCTGCCTCCA
CCGCCGCCTCCACCACCTGCCGCACCTTTCCATCCTCCTGGACCCCATGGAAATTTTTCTGGGCCCCCAGTACCGCCCCACGGAAATAACTATCACCGTC
CACCAGCACCACCACCTCCGAATAATGCATACCATTTGCAGCCACCACCACCGCATCCACCACCACCGCATCCACCAGGTCCGAATCAGTTCCCATATAT
GCCACCTGAACACCAACAAAGAGCACAACCTTGGAATTGTAATCCTCCCTATCCTGAGGGATATCAGTACAATGGACATGACAGAGGGCACCCTCCATAC
GATAGGAGACATCACTTTGATGATAGATGGCATCACTTCGACGATAGAGGGCGACGCTTTGATGATGGAGGGCATCATTTCAATGCCGGAGGGCATCATT
TTGACGATGGAGCATATCACTATGATGATAGAGGGCATCACTTCAATGACAGAGGACAAATGCACCATGAATCTATGGATAGAGGGAGGTTTCCTCCACA
TTTTGGACCAGATCCCCCGTACCCTGACCATTTTGAAGCTTCATCCTCCCACCGTGGGCGACCATCGGACGGTCCACCTGGTCCATGCACCGACTGGTCG
ATGCCGCCTAGGAGATCCAAGTATCCTCCTGGCTCCAGACATTCAATGGAGCCTCCAATGTCCCATGAAGGAGGTTGGAGGAGGCACGGAAGACACAATA
ATGATAGGTTCCATAGATGAAGGGGCAGAAGCTTTGTGTCTCAACCATGCTTAGCCTCATCTGTGATTTAGTACAATGGTTTCCAGAAGAGGGATAATTC
CTGACAATTTTAATGGTTATAGATTTTAGTTTTCTTTCCTTTTGCCTTTGGTGGGCCGTGAAGGGGATCTTCATTGTCTCCATTCGCGGACGGGCTTAGC
ATGAAATCTCTTTGCAAAAGAAGAGATGGAACAGGCCCTGGTTGTACAAATGTATGTCACCATTCTTCTGCAAATGCAGAAACGGAAGGGACTTCAATGG
TGCGTAGAGCTGTTCTGTAACAATCTAGTTAGCCTTACAGTCTACCGTGTTGTTGAGAAATTCTTCACTATTGATTTCCATTCAAATATCCCTTTTGTAA
TCC
page-top