Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6316  (registered. 2012)
Contig Information
Length 713 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_r Root 1
Wh_SH - 1
Wh_DPA20 Seed DPA20 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_SP 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig6316
GGGTGTATGATGATATTTAACTCGGGATCAAGTTTCTACAAGGCAAGCTAAATAATAAACACATATCTGACATTTCAACCTCGGTACCATCCATGAGTTT
TAAATATACAGAGGGGCTACACAAATGATGAGTTCTCGATTCGGAAGTTTTTACTGAGCTTTTTAGACAACTATATATTTATTCAAAAATTAAGACAAGC
AATTGGAACTGTAATCCAACACTTCATTCACAGGCCTTCCTTCCACCCCCAGCTTGCTGCAACATCGGCAAATGGACTCTCCAGGACCAAATCAGAAACT
CCCCCTCAGGCTCGGCAACACAGGGACGAACATAGTACCGGTTTGATCTTATTTTGGACCCCCACCCCTAATCACAAGTCCAGATGCATGCTTGATTTGA
TCCCGAATGCACAGCTGACCAATCACAATATCCAATGTTTGCCATCGACTTGCGCAACTTGTAATAACAATAATGATAAGTAACAGCAGGATTACCTCTA
GGATACGCAGCATAACAGAATTCACCAATCCTTCGCTATGAACCACCACGGTTCTGATTCATGTCAGCCTGACCGCCGGCATCAGGTGCTCCCATGGGCT
GCTGATACTGAGGTGGCAATGATGCTGGTGGTGCTCCTGCCTGGGAGTAGAAGACCTGTGCGCGGGGATCAGCAGCATACTCGGGGTACCCATAGTTTCC
CGCCATGGTCGGC
page-top