Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6313  (registered. 2012)
Contig Information
Length 514 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 2
WH_CA 1
WH_SP 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|74004228|ref|XP_854093.1|| PREDICTED: similar to germinal histone H4 gene [Canis familiaris]
Score 208
Evalue 2.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6313
GCACGAGGCTCTTCTTTCTAAGCGCACACATCCCTCGGAGCTAGGTGGATCGGCGATGTCGGGGCGCGGCAAGGGCGGCAAGGGGCTGGGGAAGGGCGGC
GCCAAGCGCCACCGGAAGGTGCTCCGCGACAACATCCAGGGCATCACCAAGCCGGCGATCCGGAGGCTGGCCAGGAGGGGCGGCGTGAAGCGCATCTCGG
GGCTCATCTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCACCTACACTGAGCACGCTCGCCGCAAGACCGT
CACCGCCATGGACGTCGTCTACGCGCTCAAGCGCCAGGGCCGCACCCTCTACGGCTTCGGCGGCTAGATTCGTGTCGTGTGTCCGTGTGTTCTGTGGAAG
ACGGGTTTTACTACTGCTTTGGCGTGCGTCGTTGTGTTCCGTCTTGTGTTCATTAGGCTGTAATTCCTTGTTGCGGTCAATGAAACTAGTTCTGTTCTGA
AAAAAAAAAAAAAA
page-top