Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6310  (registered. 2012)
Contig Information
Length 1263 bp
Clones alternative view 47 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_f Spike at flowering date 3
Wh_oh Pistil at heading date 2
Wh_r Root 1
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 3
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_SP 4
WH_XA Root 2
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125556754|gb|EAZ02360.1|| hypothetical protein OsI_24464 [Oryza sativa Indica Group]
Score 446
Evalue 2.00E-123
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6310
TTAATAATCATTAAACAAGGTACACAACCGTTGCAAATCTCTTGGAGCAAGGACAGACCTCAAACTATGAAGAAATCTAAGGCAGCTGGCCAATACTGTT
TTATAAGAATGAGAAGATAATCAAATGAAAAACAGTACGCTGACCTCCAAACCGAAGAAATGCTAATGCCATAACGGTAAGTGTATGTGAAACCACGCAG
CTCTAAGATCAAATAAGATCAGAAATCCCATAGATAACATATACCTTCAACAAAATTGTGTTTCAAGGAAAACTATCTGTAAAGTACACAGCAAGGTCGA
AAATGGTGTCATCAAGGTGTGCAGCCACGAGACTAGTTCAAACACCTCCGCTCTCTCATCTATCCAGGTTACTTGTGAAGGGCTGCCCTCGATTTGTCTC
ATTCTAGATCCTGAAATGTCTAGCTAGGCCCAGCAACCTCGAATCTATTTGTTTTTCTTGGCTTTGTCCTTTGCAAACGCGGTACCCTCCAGCCACTCGT
CCATGTTGGCATCAGTTGTTCCAGTTCCGAGTTCCACCTTGGGGCCTTTCTTTGTTTTCTTCGAGAGCTGTTGCACTTGACCATAAGCCCACAATCCTAG
GAGACCAAGAAGTGCAATTCCAAGGGTAATAAGGAACACAGATTCAACACTCAGTAACCCTCCGACCTCAACAACCTCAATGGTGCCATTGTAGAATACG
TTCTGATAAGGGTGCTGATCAATCTCGTACACAATGTAACCAACAAGATCATATGCTCCAGGCTGCAAGAATTTGCTCACGGCAAATGTATAGGGAAAGG
TTGCTTGCACAGAGACAGGAACTGATGCATTGTAGAAACTCTGAACTGTAAGGTTTTGTCCATACATTTTATGATCATAAGGAAGATGCAGGGTTGAATG
GACAGCAACCACATTCAAATTTGATTCACCCTCATTTTGCAGGCCAACCAAGAGCTCAGTTTCTTCACCCGCTGGTACAATTTTCCCAGCATTTTTGGGG
AAGACACAAACAGTCTCCACACCAGGAGCAGGGCTTAAAGGCTCTTCACTGGAAACCGGAGTATCGTCACCCACATATCCTAGATCAGCCCCATCAACAA
CTTCTTGCATAGCAGCATCTTCCTCAGACTGAGCTCTAGCAACTTGGGCGAAGGGGGAGGCGGCGAGGAGGAAGGCGAGGAGGAAGGCGGAGAGCCAAAC
CCTAACCGCCATGGCCGGCTCAGTCAGATCGGATCAGGATGGAGGGAGAGGGAGGAGGTGGTG
page-top