Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig630  (registered. 2012)
Contig Information
Length 1507 bp
Clones alternative view 136 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_h Spike at heading date 1
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 58
Wh_EM Dormant seed with water absorption 11
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 25
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_SP 2
WH_XA Root 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig630
CGATCCGACCGACGGTAAACAGTCGCAACGATGTCCCTCCAATGTCGCCTCCGGAAAAACGTTGCCCCTCGGTGGCAACGTCATCGCTGTCCCGGTCTCC
TGTACGTCTCAAGTGAAATTCTGACCCAACAGCCGAATGCGGCTCGGGAAACAGGAAAGTAGCCCGTTTCGTGCATGATAAGACCGTCCGACAACGTTGC
ACCGATGTCCCGATAAAGTTGCCTTTGGAAAATCGTTGCATCCGTAGCTTTATTGCTGCTGGTGTGACACGCGTGATTTGGCCTTGCAGGACGCCTTCGT
GCAAGTGATCCTCCCGTGCTCTGCACGGGCGGAGGCTTGGTTGGTTTGACCGCTTGTTGGCTACTAAGCGCATGAGTAGCTTTGGACCCGTGTCTGCCGG
TAGATCCCCCGTTGTACTGCGGCCGACTACCGGCGCCGTGTCCCGTCCCTCGTGTGGCTTCGAATCGCTGGATTAAGAGTGCTTGCGTGCTAGTACCCGA
CCTACGGGAAGTGGTGCTTCGGATAATTGTTGCCTCGCGGCGGACGCCCATTGGGTGTGCCGCTGCGGCCAAATAGCGCTTGCGGCGTTGCCTCGTGGGG
CTGGCACATTACGTGCCCGTTGCTATCAAGGCAACCTCGCTCCCGCTTTTGGTCTCGGATGCTGCTGACGATAAAGGGTCGTGGCCCTTTCGGTTGCCTC
GACCCGACCCAAAGCTCTCGGAACTGAGAACAACCGGAACAGGAGTTGCCTCTACCTCTCCACAGTTACGTGGTAGGATACGCAACTCTCTGCGCCGATC
CTCAAGGATGATGAGCTGTGCCGCTCAAGAGCGACGACCGGCCCGGCTGTTGCCTCTGAGTTTCCACGGAAGTGGAAGCGCAGAACGATGGCCGTGCTGG
TAGTCACCAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAGTATGAACCAATTTGAACTG
TGAAACTGCGAATGGCTCATTAAATCAGTTATAGTTTGTTTGATGGTACGTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACC
CCGACTTCTGGGAGGGGCGCATTTATTAGATAAAAGGCTGACGCGGGCTCTGCTCGCTGATCCGATGATTCATGATAACTCGACGGATCGCACGGCCTTC
GTGCCGGCGACGCATCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGGGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGA
TTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACGGGGAGGTAGTGACAATAAATAA
CAATACCAGGCGTCCAGCCCCACTCCTTCGTCCGGCTGGCGGGACATATTTCATGTGCCCTGCATGCCATCCGTCGGCTTTGGTGAGCTTTGCCAGCGGG
CGGTCAG
page-top