Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6292  (registered. 2012)
Contig Information
Length 742 bp
Clones alternative view 99 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 13
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 4
Wh_r Root 8
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 6
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 7
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 9
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_SP 14
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32400774|gb|AAP80619.1|AF475097_1|AF475097_1 acidic ribosomal protein P2 [Triticum aestivum]
Score 215
Evalue 3.00E-54
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6292
GCACGAGGCCTCGTGCCGAATTCGGCACGAGGGAAACCCTAGCAGATCGCTCGAGCCCTCCGCCGCCGCCGCGCCTTCAGCTCTCTCCTTCCTTCACCGA
TTCAAGATGAAGTTCATCGCTGCCTATCTGCTTGCTTACCTCTCTGGCAACGCCAGCCCCTCTGCAGAGGACCTGACATCCATTCTTGAGTCAGTTGGTT
GTGAAATCGACAATGAGAAGATGGAACTCATGCTGTCCCAAGTGAAGGGCAAGGACATCACTGAGCTCTTGGCTGCTGGTAGGGAGAAGTTTGCTGCGGT
TCCATCTGGTGGTGGTGGTGTGGCTGTTTCAGCCGCTGCTCCTGCTGCTGGTGGTGCTGCTGCCCCTGCAGCTGAGTCGAAGAAAGAAGAGAAGGTCGTG
GAGAAGGAAGAGAGTGATGATGACATGGGCTTCAGTCTGTTCGACTAAGTCGTGGGGCATCTTGTGTCTGCAGTATCTATCCTTGGCCAGGAAACTAGAG
TCAATGATGTTTTAGCCTTTATTTAGCTGAGTTGTGAAACGCTGGCAAGACAATGTTTTGATATGTAATTCAGCCCCTGGTTGCTGGTTGATTTACTGGT
GAACCATACCTTTGCTATCCAATTTTGGTGCTTTAACAATGCATTGTTTTGATATGTTCTGCCAAAAAAAAAAATCCTCTATGGCTTCCCCATTTTCTTA
AGTNNNNNNNCGACCTAATTCAGATTTCTTTGTAAATCGGCA
page-top