Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6284  (registered. 2012)
Contig Information
Length 726 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_SP 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68299599|dbj|BAE02729.1|| PIP aquaporin [Hordeum vulgare]
Score 295
Evalue 3.00E-78
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6284
ATTCTCCACATGCATACATACATACATAGAGCGAGTAAATGGATAGCACACTTGGAAGAAACAGCAGCAAGCAAACATGGCGAACTCCGGAACACGTCGA
CGTACGAATGGACGGTCACATCGACATATGCACAAGCCGAGGAACGGTAGCAGCTGATGATGCAAAGACTGGAGCCACTGAACAGGACAAAGGTGTGGGA
TCGAGCAACCATAGCGCATTTGCTGGAGGCGGCCTTCTTCTTCGCACATATCTACACTTCAGTCCGGCCGGAGCGACGGCCGGCTTAGTTGCTCCTGTAG
GACCCGAGCTTGGCGGCGCTGGCCCTCAGCACGTACTGGTGGTAGGCGGCGGCGATGGCGGCGCCGATCAGCGGCCCCACCCAGAAGATCCATTGGTCAT
CCCAGGCCTTGTCTTTGTTGTAGATGACAGCAGCTCCCAAGCTTCTCGCCGGGTTGATGCCGGTGCCGGTGATGGGGATGGTGGCCAGGTGGACCATGAA
CACGGCGAATCCGATTGGGAGAGGAGCCAGCACCGGGATGTGGGAGTCACGGGCGTTGCGCTTGGGGTCGGTGGCGGAGAAGACGGTGTAGACGAGCACG
AAGGTGCCGATGATCTCGGCCGCGAGCCCGGTGCCCTTGGAGTAGCCTGCGCTGAGCTCGTTGGCGCCGCCGCCGTACCGCACGTAGTAGGAGCTCTGGA
AGCCCTTGACCAGCCCGACGCCGCAG
page-top